apeiros changed the topic of #ruby to: Ruby 2.2.1; 2.1.5; 2.0.0-p643: https://ruby-lang.org || Paste >3 lines of text on https://gist.github.com || this channel is logged at http://irclog.whitequark.org, other public logging is prohibited
Takumo has quit [Remote host closed the connection]
plasku has quit [Remote host closed the connection]
Morrolan has quit [Quit: ZNC: Shutting down.]
jtreminio has left #ruby ["Linkinus - http://linkinus.com"]
Nightmare has quit [Remote host closed the connection]
elfuego has left #ruby [#ruby]
OrbitalKitten has quit [Read error: Connection reset by peer]
sevvie has joined #ruby
OrbitalKitten has joined #ruby
sinkensabe has joined #ruby
_1_moamen has joined #ruby
Zai00 has joined #ruby
_1_moamen has quit [Remote host closed the connection]
<shevy> oh I just realized
<shevy> in a regex ... \d{0,5}
<shevy> that is similar to \d? right? in other words optional... 0 up to 5 matches
<bradland> yep
<jhass> shevy: * and + are mere shortcuts to {0,} and {1,}
<shevy> aha
<havenwood> shevy: \d{,5}
sinkensabe has quit [Ping timeout: 272 seconds]
elfuego has joined #ruby
Fire-Dragon-DoL has quit [Quit: Leaving.]
claw has joined #ruby
FooMunki_ has quit [Quit: FooMunki_]
centrx has quit [Ping timeout: 244 seconds]
sevvie has quit [Ping timeout: 250 seconds]
<bradland> shevy: I use this tool as a starting point for a lot of my regex: http://txt2re.com
<shevy> so far my regex looks like this /(\w*-?\w+-?\w+)-(\w{0,10}\d{1,10}+?\.?\d{1,10}?+\.?\d{0,5}-?\w{0,5})/
Takle has quit [Remote host closed the connection]
zubov has joined #ruby
dorei has quit []
<bradland> although, it's really best suited for stuff like log parsing, where you're likely to have common patterns
<shevy> that site is better than rubular.com?
<bradland> different
jespada has quit [Quit: WeeChat 1.1.1]
<bradland> that site will identify common patterns in a string, then allow you to click to construct a base regex
<shevy> well these are the different input matches so far
jonr22 has joined #ruby
<shevy> gaim-1.2 WebKit-r93670 subtle-0.11.3224-xi util-linux-ng-2.15 CrownCutlass-Alpha1.4
<bradland> it actually gives you code, but i tend to copy/paste the concatenation in to pry and get the regex back
<bradland> what's your source text?
<bradland> and desired match criteria?
<bradland> these look like package names
<shevy> yeah
<shevy> I need to split them into name and version
<bradland> txt2re probably won't help with this much, but there are some general techniques that apply here
scripore has quit [Quit: Leaving]
<bradland> because these package names "pack" the package and version data differently
<shevy> the main pattern I have right now is
<bradland> you're probably going to want to profile the package name, then send it to a parser that handles it specifically
<shevy> ()-() <--- where the central - is the one that is used for splitting, the other two () set the pre and post match
<shevy> so webkit is ... (WebKit)-(r93670)
<bradland> packages like util-linux-ng-2.15 trip you up though
<shevy> util-linux-ng-2.15 is (util-linux-ng)-(2.15)
<shevy> haha yeah
<bradland> you could build a general regex for this, but i always hate doing that
<bradland> because my regexes become undecipherable to my future self
<shevy> yeah
jenrzzz has quit [Ping timeout: 240 seconds]
<shevy> how lovely it would be to use a simple regex
<shevy> (\w+)-(\d+)
<bradland> so, despite the fact that it has greater overhead, i'll use a profiling regex, then hand off to the appropriate parsing regex
sevvie has joined #ruby
jonr22 has quit [Ping timeout: 252 seconds]
Azure has joined #ruby
<shevy> I shut down my brain already
<shevy> now I am just feeding rubular with sample data
<shevy> I found another input that annoys me
<shevy> acl_2.2.47-1
<bradland> look at how request-log-analyzer does it for rails logs
toretore has quit [Quit: This computer has gone to sleep]
<bradland> rails logs, mind bogglingly, are not in standard log format
<shevy> why can't these people use a -
botwin has joined #ruby
<shevy> or debian packages
<bradland> each request/response cycle is logged as a "block"
botwin has quit [Client Quit]
<shevy> and when you extract it, it suddenly becomes dpkg-1.17.10
<bradland> so rla (request-log-analyzer) profiles each line with a line_definition
<shevy> 95% of the programs out there behave in that (\w+)-(\d+) scheme really
zachrab has joined #ruby
<bradland> it says: if the regex teaser matches, it's this type of line, so we'll break it up using the regexp
<bradland> have you run (\w+)-(\d+) against some of those results?
<bradland> because i don't think it does what you think it does
<bradland> even in simple cases
chipotle has joined #ruby
tgunr has quit [Ping timeout: 264 seconds]
<shevy> oh
<shevy> you can actually have more than one line as input string?
<shevy> :)))
<shevy> I did with only one line each!
<shevy> then I removed the old line
<shevy> and put up new data haha
<bradland> oh man
<bradland> lol
<bradland> you poor soul
<shevy> bradland well ok, it's a bit more tweaking
<bradland> because you have a couple of different identifiable patterns here
<bradland> that could use different parse strategies
<shevy> btw how do I make such a link in rubular?
<bradland> faaaaaar more easily than trying to build a general case regex
<bradland> there's a "Make Permalink" button in the bottom center
<shevy> oh
<shevy> yeah
<shevy> now I need to add that annoying acl ... but perhaps I just refuse such input...
<shevy> but it's cool that you can test more than one input there
<bradland> yeah, very helpful
zachrab has quit [Ping timeout: 245 seconds]
<bradland> have a look at your matches though
<bradland> yikes
<shevy> hmm I have another question
<shevy> we use () to capture a match right? but rubular also says: (a|b)
<shevy> "a or b"
<shevy> so now I am confused
<shevy> isn't that also a match?
bogeyd6 has quit [Ping timeout: 255 seconds]
<bradland> (capture)
<bradland> (this|that)
<bradland> capture this or that
kromm has joined #ruby
<bradland> | is the or operator
<shevy> yeah but then I must add another match group or?
<shevy> for instance, take acl_
wldcordeiro has quit [Ping timeout: 265 seconds]
<shevy> so the separator will be _ as is the case in acl, or - as is the case in gaim-1.2
<bradland> yeah, i think you need to use a group in order to use or
<shevy> so ... it would be like: (\w+)(_|-)(\d+) or?
<shevy> ok
<bradland> use this instead
bogeyd6 has joined #ruby
<bradland> (\w+)[_-](\d+)
<shevy> huh
piotrj_ has joined #ruby
<bradland> [] are used to build your own character classes
FooMunki_ has joined #ruby
<bradland> so \d is any digit, right?
<shevy> yay!
mroach has quit [Quit: mroach]
<shevy> your [] thing worked
<bradland> [_-] is underscore or dash
<bradland> but without the or operator
havenn has joined #ruby
javaserver has joined #ruby
<bradland> getting closer
<shevy> hehe
ScioMin has joined #ruby
<bradland> that regex makes my head hurt, but it's getting closer!
javaserver has quit [Client Quit]
Dolphi has quit [Ping timeout: 272 seconds]
<bradland> as you're building this, don't forget to collect lines that don't match your regex at all
<shevy> it can probably be simplified
fgo has joined #ruby
thumpba has joined #ruby
<shevy> but I just want to have the sample input work and move on!
piotrj has quit [Ping timeout: 272 seconds]
<shevy> irb displays the regex curiously
<shevy> # => w-w-w-{0,10}[-]w{0,10}d{1,10}d{1,10}d{0,5}-w{0,5}
<bradland> check match group 5
havenwood has quit [Ping timeout: 252 seconds]
<bradland> although i guess that's a "version" by their standard
Zai00 has quit [Quit: Zai00]
<bradland> yeezus
dfinninger has joined #ruby
<bradland> 0.11.3224-xi is a version number? wow
javaserver has joined #ruby
<jhass> >> "foo"[/foo|bar/]
<eval-in_> jhass => "foo" (https://eval.in/297154)
javaserver has quit [Client Quit]
Limix has quit [Quit: Limix]
<jhass> don't need a group if you don't want to chain
<jhass> >> "foo"[/(?:foo|bar)/] # and it works fine in a non-capturing group
<eval-in_> jhass => "foo" (https://eval.in/297156)
<shevy> most projects really work just fine
Channel6 has joined #ruby
<shevy> like all of the gnome tarballs, they have a simple scheme such as libgnome-2.32.1
Morrolan has joined #ruby
arescorpio has joined #ruby
jottr has quit [Ping timeout: 250 seconds]
jenrzzz has joined #ruby
<shevy> jhass hmm what is the leading ? there doing?
<shevy> "foo"[/(?:foo|bar)/]
<bradland> what data are you querying?
javaserver has joined #ruby
<bradland> makes it a non-capturing group
<jhass> (?:) is a non-capturing group
javaserver has quit [Client Quit]
<shevy> bradland all available wget-able source archives out in the wild
<shevy> I can probably show you all URLs a bit later, will be around 2700
<bradland> if you're pulling from places distribution package managers, they maintain indexes of those things
<bradland> which will have all this data separated already
jottr has joined #ruby
charliesome has joined #ruby
<jhass> >> "abcdefg".scan(/(?:[a-d])|([e-g])/)
<eval-in_> jhass => [[nil], [nil], [nil], [nil], ["e"], ["f"], ["g"]] (https://eval.in/297158)
<bradland> although i see you're pulling from sourceforge too
<shevy> hmm ok so .. (?:) has nothing to do with when we use ? for an optional match, such as /a?/
<jhass> yup
<bradland> regex, babyyyyyyyy!
ScioMin has left #ruby ["GG"]
dfinninger has quit [Ping timeout: 246 seconds]
thumpba has quit [Remote host closed the connection]
<jhass> the fun starts with lookaround expressions and possessive quantifiers
<shevy> bradland I found another funny archive:
plashchynski has quit [Quit: plashchynski]
<shevy> ftp://ftp.ncbi.nlm.nih.gov/toolbox/ncbi_tools++/ARCHIVE/12_0_0/ncbi_cxx--12_0_0.tar.gz
<apeiros_> jhass: atomic expressions are the real fun
<shevy> which - is the more important one ;)
<shevy> though the answer is probably consistent, the very first - right before a number
<shevy> but I am thinking, what are these guys smoking!
<shevy> and the _ version name... boost has that as well: http://sourceforge.net/projects/boost/files/boost/1.56.0/boost_1_56_0.tar.bz2
<shevy> I think it must be some C++ thing
<jhass> apeiros_: yeah yeah, possessive quantifiers are just the lazy mans way to write them
<jhass> which JS had them
<jhass> *wish
boshhead has joined #ruby
<bradland> shevy: your chances of success with a general case regex are going up in a puff of smoke!
rbennacer has joined #ruby
sprink has left #ruby [#ruby]
<shevy> hehe
mroach has joined #ruby
<bradland> you can get pretty close with a much simpler regex too: http://www.rubular.com/r/agdHe5lCO0
<bradland> you could do something like that, then postprocess the matches
jenrzzz has quit [Ping timeout: 246 seconds]
crdpink2 has joined #ruby
<bradland> also, be careful when using - inside []
<bradland> [a-z] matches a through z
blizzy has joined #ruby
<bradland> if you want literally, a, -, z, you have to escape the -
<bradland> or put it at the end
crdpink has quit [Ping timeout: 256 seconds]
_Andres has quit [Quit: My Mac Pro has gone to sleep. ZZZzzz…]
<shevy> hmm
<bradland> [az-] or [a\-z]
<bradland> i prefer the former
<shevy> so many things to keep in mind
_blizzy_ has quit [Ping timeout: 246 seconds]
<shevy> that regex is more complicated than the rest of the code :(
blizzy is now known as _blizzy_
<bradland> i am a regex *novice*
<bradland> absolute novice
Limix has joined #ruby
<shevy> I am always happy when I can get away with code that is so simple that I don't have to think
RegulationD has joined #ruby
<bradland> broken record, but, i think if you approach this differently, it's much simpler
riotjones has joined #ruby
spider-mario has quit [Remote host closed the connection]
<bradland> hell, you can use a case/when as your dispatcher
<shevy> hmm
<shevy> boost_1_54_0.tar.bz2 trips me up
<shevy> why do these guys use _
<bradland> the profile for that is, it contains no dashes, no dots
<bradland> (after you drop the extension, of course)
<shevy> yeah, I get rid of the extension parts before
<bradland> so you have an "all underscore" filename
<bradland> what's your strategy for parsing those?
<shevy> can you give an example?
<bradland> it's probably different than when there are dashes and dots, right?
nii236 has joined #ruby
<bradland> sure, lemme see if i can get something working
<shevy> well for the _, all examples so far have a "word_number" part which is the same as "word-number"
<bradland> shit
<bradland> i gotta run bud
<shevy> except for WebKit-r93670 perhaps... I have not yet seen a WebKit_r93670 example yet... or WebKit_r_9_3_6_7_0
<bradland> the wife is ready to head to dinner
<shevy> cya
Adran has quit [Quit: Este é o fim.]
Feyn has joined #ruby
Regulati_ has joined #ruby
crdpink has joined #ruby
riotjones has quit [Ping timeout: 256 seconds]
RegulationD has quit [Ping timeout: 272 seconds]
zubov has quit [Quit: Leaving]
crdpink2 has quit [Ping timeout: 256 seconds]
nfk has quit [Quit: yawn]
rbennacer has quit [Remote host closed the connection]
thumpba has joined #ruby
sinkensabe has joined #ruby
shadeslayer has quit [Ping timeout: 245 seconds]
rbennacer has joined #ruby
willgorman|away has quit [Ping timeout: 256 seconds]
shadeslayer has joined #ruby
SouL has joined #ruby
willgorman has joined #ruby
Regulati_ has quit [Ping timeout: 272 seconds]
plutonic has quit [Quit: plutonic]
jonathanwallace has quit [Ping timeout: 245 seconds]
RegulationD has joined #ruby
gsvolt has quit [Quit: No Ping reply in 180 seconds.]
sinkensabe has quit [Ping timeout: 264 seconds]
gsvolt has joined #ruby
plutonic has joined #ruby
CorySimmons has joined #ruby
crazydiamond has quit [Remote host closed the connection]
jonathanwallace has joined #ruby
thumpba_ has joined #ruby
thumpba has quit [Read error: Connection reset by peer]
rbennacer has quit [Remote host closed the connection]
Stalkr^ has quit [Quit: Leaving...]
redchicken has joined #ruby
SouL has quit [Remote host closed the connection]
RegulationD has quit [Ping timeout: 244 seconds]
fgo has quit [Ping timeout: 252 seconds]
leafybasil has quit [Read error: Connection reset by peer]
charliesome has quit [Quit: zzz]
leafybasil has joined #ruby
spicerack has joined #ruby
spicerack has joined #ruby
ferr has quit [Quit: WeeChat 1.1.1]
aphprentice_ has quit [Remote host closed the connection]
soulcake has quit [Ping timeout: 276 seconds]
crdpink2 has joined #ruby
crdpink has quit [Ping timeout: 265 seconds]
justin_pdx has joined #ruby
teddyp1cker has joined #ruby
paradisaeidae has joined #ruby
<shevy> I have a question: http://www.rubular.com/r/Gas2zC5PpW
<shevy> test string is: x = 'boost_1_54_0'
<shevy> regex is: regex = /(\w+)_(\d{0,3}_?)/
<shevy> this will create two match groups: (1) "boost_1_54" and (2) "0"
<shevy> now I'd like to match against the first _, not the last
teddyp1cker has quit [Ping timeout: 240 seconds]
<shevy> so that I would get (1) "boost" and (2) "1_54_0"
<shevy> is there some way to have that?
chipotle has quit [Remote host closed the connection]
<shevy> aha
<shevy> with this regex it matches: ([a-z]+)_(\d{0,3}_?\d{0,3}_?\d{0,3}_?)
pontiki has joined #ruby
<shevy> I guess one problem is that \w matches _ as well. Still curious how to make a match less greedy
<jhass> >> "oooo"[/o+?/]
<eval-in_> jhass => "o" (https://eval.in/297174)
n008f4g_ has quit [Quit: leaving]
<shevy> I just looked up
thumpba has joined #ruby
<shevy> so the ? means non-greedy right? I thought it was optional
<jhass> yes
dseitz has joined #ruby
<canton7> everything in regex means a bazillion different things depending on context
<canton7> (?:...) is a non-capturing group for instiance
Guest123 has quit [Quit: My MacBook Pro has gone to sleep. ZZZzzz…]
charliesome has joined #ruby
chipotle has joined #ruby
marr has quit [Ping timeout: 240 seconds]
thumpba_ has quit [Ping timeout: 272 seconds]
commmmodo has quit [Quit: commmmodo]
mary5030 has joined #ruby
martinbmadsen has joined #ruby
dfinninger has joined #ruby
<waxjar> shevy, would split("_", 2) work?
paradoja has quit [Ping timeout: 245 seconds]
<paradisaeidae> I'm attempting to enable TLSv1_2 in a fork of eventmachine. http://jsfiddle.net/#&togetherjs=wFJsNNkGGS
<shevy> waxjar the problem is that some input does not have any _
Guest123 has joined #ruby
martinbmadsen has quit [Ping timeout: 272 seconds]
<shevy> waxjar here is the sample input that seems to work right now: http://www.rubular.com/r/QIhmgNN3GB
Dolphi has joined #ruby
dfinninger has quit [Ping timeout: 272 seconds]
robustus has quit [Ping timeout: 255 seconds]
Takle has joined #ruby
<shevy> another improvement: http://www.rubular.com/r/z5cRy511di
<redchicken> ruby got accepted for gsoc
tubuliferous has quit [Quit: My Mac has gone to sleep. ZZZzzz…]
<redchicken> quick - someone tackle the gil with google money
<havenn> shevy: drop all the zeros before the commas
kromm has quit [Quit: kromm]
bruno-_ has quit [Ping timeout: 246 seconds]
<shevy> k
FooMunki_ has quit [Ping timeout: 246 seconds]
robustus has joined #ruby
FooMunki has joined #ruby
diegoviola has quit [Quit: WeeChat 1.1.1]
jcdesimp has quit [Remote host closed the connection]
Nightmare has joined #ruby
hiyosi has quit [Quit: My Mac has gone to sleep. ZZZzzz…]
rhg135 has quit [Ping timeout: 256 seconds]
Takle has quit [Ping timeout: 252 seconds]
FooMunki_ has joined #ruby
Yzguy has joined #ruby
FooMunki has quit [Ping timeout: 256 seconds]
FooMunki_ is now known as FooMunki
oo_ has joined #ruby
oo_ has quit [Remote host closed the connection]
Limix has quit [Quit: Limix]
jblancett has quit [Remote host closed the connection]
bradland has quit [Remote host closed the connection]
zachrab has joined #ruby
rhg135 has joined #ruby
bigmac has joined #ruby
chipotle has quit [Quit: cheerio]
lkba has joined #ruby
lkba_ has quit [Read error: Connection reset by peer]
drPoggs has quit [Quit: +++ATH]
crdpink has joined #ruby
nii236 has quit [Ping timeout: 240 seconds]
FooMunki has quit [Quit: FooMunki]
crdpink2 has quit [Ping timeout: 256 seconds]
blackmesa has quit [Ping timeout: 272 seconds]
davedev2_ has quit [Ping timeout: 252 seconds]
Limix has joined #ruby
zachrab has quit [Ping timeout: 264 seconds]
Deele has quit [Ping timeout: 256 seconds]
davedev24_ has joined #ruby
covercash has quit [Remote host closed the connection]
a5i has joined #ruby
n80 has joined #ruby
maletor has joined #ruby
jonr22 has joined #ruby
fgo has joined #ruby
bigmac has quit [Read error: No route to host]
bigmac has joined #ruby
bigmac has quit [Read error: Connection reset by peer]
Dolphi has quit [Ping timeout: 246 seconds]
greenbagels has joined #ruby
nii236 has joined #ruby
mary5030 has quit [Remote host closed the connection]
jonr22 has quit [Ping timeout: 245 seconds]
fgo has quit [Ping timeout: 252 seconds]
lemur has quit [Remote host closed the connection]
n80 has quit [Quit: n80]
Hirzu has joined #ruby
n80 has joined #ruby
n80 has quit [Client Quit]
amystephen has quit [Quit: amystephen]
Hirzu has quit [Ping timeout: 244 seconds]
covercash has joined #ruby
justin_pdx has quit [Quit: justin_pdx]
Adran has joined #ruby
sevvie has quit [Ping timeout: 256 seconds]
jenrzzz has joined #ruby
millerti has joined #ruby
hiyosi has joined #ruby
plutonic has quit [Quit: plutonic]
greenbagels has quit [Quit: Leaving]
sevvie has joined #ruby
a5i has quit []
jenrzzz has quit [Ping timeout: 252 seconds]
[gmi] has quit [Read error: Connection reset by peer]
martinbmadsen has joined #ruby
Asher has quit [Quit: Leaving.]
dfinninger has joined #ruby
commmmodo has joined #ruby
covercash has quit []
apeiros_ has quit [Remote host closed the connection]
Sirupsen has joined #ruby
apeiros_ has joined #ruby
riotjones has joined #ruby
martinbmadsen has quit [Ping timeout: 256 seconds]
red_horned_rihno has quit [Ping timeout: 240 seconds]
thumpba has quit [Remote host closed the connection]
dfinninger has quit [Ping timeout: 272 seconds]
tus has quit []
Spami has quit [Quit: This computer has gone to sleep]
thumpba has joined #ruby
Rephiax has joined #ruby
DerisiveLogic has joined #ruby
riotjones has quit [Ping timeout: 252 seconds]
rudolpholiver has joined #ruby
<rudolpholiver> yeahhhhhhhhhhhh!
jcdesimp has joined #ruby
Takle has joined #ruby
greenbagels has joined #ruby
RegulationD has joined #ruby
Takle has quit [Ping timeout: 246 seconds]
Yzguy has quit [Quit: I'm sleeping, go away.]
red_horned_rihno has joined #ruby
hmsimha has quit [Ping timeout: 252 seconds]
chrishough has joined #ruby
maletor has quit [Quit: Computer has gone to sleep.]
zorak8 has quit [Ping timeout: 256 seconds]
Hobogrammer has quit [Ping timeout: 250 seconds]
Hien has quit [Remote host closed the connection]
a5i has joined #ruby
meatherly has quit [Remote host closed the connection]
RegulationD has quit [Remote host closed the connection]
rudolpholiver has quit [Quit: vestinst.com]
nii236 has quit [Ping timeout: 244 seconds]
G has quit [Remote host closed the connection]
miah has quit [Quit: Lost terminal]
zorak8 has joined #ruby
Joufflu has joined #ruby
sinkensabe has joined #ruby
JBreit has quit [Quit: Leaving]
elektronaut has joined #ruby
tag has joined #ruby
Yzguy has joined #ruby
RegulationD has joined #ruby
sinkensabe has quit [Ping timeout: 264 seconds]
thumpba has quit [Remote host closed the connection]
fgo has joined #ruby
RegulationD has quit [Ping timeout: 250 seconds]
fgo has quit [Ping timeout: 252 seconds]
Yzguy has quit [Quit: I'm sleeping, go away.]
Limix has quit [Read error: Connection reset by peer]
mary5030 has joined #ruby
plutonic has joined #ruby
Limix has joined #ruby
nii2361 has joined #ruby
teddyp1cker has joined #ruby
Limix has quit [Client Quit]
aaa1231-2 has quit [Ping timeout: 246 seconds]
teddyp1cker has quit [Ping timeout: 256 seconds]
OrbitalKitten has quit [Quit: Textual IRC Client: www.textualapp.com]
justin_pdx has joined #ruby
jottr has quit [Ping timeout: 246 seconds]
mary5030 has quit [Remote host closed the connection]
plutonic has quit [Quit: plutonic]
yfeldblum has joined #ruby
jonr22 has joined #ruby
TripTastic has quit [Read error: Connection reset by peer]
iamjarvo has joined #ruby
Sawbones has joined #ruby
yfeldblu_ has quit [Ping timeout: 265 seconds]
dfinninger has joined #ruby
Guest123 has quit [Quit: My MacBook Pro has gone to sleep. ZZZzzz…]
nii2361 has quit [Ping timeout: 264 seconds]
pork_clips has joined #ruby
thumpba has joined #ruby
_cake has quit [Ping timeout: 244 seconds]
plutonic has joined #ruby
plutonic has quit [Client Quit]
dfinninger has quit [Ping timeout: 256 seconds]
iamjarvo has quit [Quit: My MacBook has gone to sleep. ZZZzzz…]
zachrab has joined #ruby
iamjarvo has joined #ruby
Sirupsen has quit [Quit: Textual IRC Client: www.textualapp.com]
jeromelanteri has joined #ruby
Limix has joined #ruby
charliesome has quit [Quit: zzz]
bruno- has joined #ruby
zachrab has quit [Ping timeout: 264 seconds]
jottr has joined #ruby
CorySimmons has quit [Quit: Bye!]
martinbmadsen has joined #ruby
jcdesimp has quit [Remote host closed the connection]
iamjarvo has quit [Quit: My MacBook has gone to sleep. ZZZzzz…]
bruno- has quit [Ping timeout: 255 seconds]
epochwolf has quit [Quit: Uh no...]
arescorpio has quit [Excess Flood]
leslie has quit [Quit: Have you ever tried to eat a clock? It's very time consuming.]
lemur has joined #ruby
iamjarvo has joined #ruby
martinbmadsen has quit [Ping timeout: 246 seconds]
iamjarvo has quit [Max SendQ exceeded]
iamjarvo has joined #ruby
jcdesimp has joined #ruby
wldcordeiro has joined #ruby
nii2361 has joined #ruby
jcdesimp has quit [Remote host closed the connection]
jcdesimp has joined #ruby
braincrash has quit [Quit: bye bye]
sinkensabe has joined #ruby
iamjarvo has quit [Ping timeout: 265 seconds]
millerti has quit [Quit: My Mac has gone to sleep. ZZZzzz…]
millerti has joined #ruby
maximski has joined #ruby
zorak8 has quit [Ping timeout: 272 seconds]
zorak8 has joined #ruby
maximski has quit [Client Quit]
Hirzu has joined #ruby
sinkensabe has quit [Ping timeout: 245 seconds]
braincrash has joined #ruby
sevvie has quit [Ping timeout: 252 seconds]
Spami has joined #ruby
amystephen has joined #ruby
davidhq has joined #ruby
davidhq has quit [Client Quit]
boshhead has quit [Ping timeout: 256 seconds]
Hirzu has quit [Ping timeout: 272 seconds]
davidhq has joined #ruby
bricker has joined #ruby
hmsimha has joined #ruby
thumpba has quit []
<bricker> git bisect is amazing but I wish I could tell it to help me find when something was *fixed*
<bricker> besides just manually reversing "good" and "bad"
Yzguy has joined #ruby
Yzguy has quit [Quit: I'm sleeping, go away.]
philwantsfish has quit [Read error: Connection reset by peer]
nii2361 has quit [Ping timeout: 265 seconds]
Caius has quit [Ping timeout: 276 seconds]
sevvie has joined #ruby
riotjones has joined #ruby
RegulationD has joined #ruby
Caius has joined #ruby
riotjones has quit [Ping timeout: 240 seconds]
<eam> how is "fixed" different from good/bad?
RegulationD has quit [Ping timeout: 246 seconds]
dfinninger has joined #ruby
sivsushruth has quit [Ping timeout: 245 seconds]
paradisaeidae has quit [Quit: ChatZilla 0.9.91.1 [Firefox 36.0.1/20150305021524]]
mary5030 has joined #ruby
chrishough has quit [Quit: My Mac has gone to sleep. ZZZzzz…]
dfinninger has quit [Ping timeout: 265 seconds]
lemur has quit [Remote host closed the connection]
justin_pdx has quit [Quit: justin_pdx]
mary5030 has quit [Ping timeout: 250 seconds]
duncannz has quit [Remote host closed the connection]
sevvie has quit [Ping timeout: 252 seconds]
sevvie has joined #ruby
martinbmadsen has joined #ruby
jonr22 has quit [Remote host closed the connection]
Guest123 has joined #ruby
Soda has quit [Remote host closed the connection]
RegulationD has joined #ruby
martinbmadsen has quit [Ping timeout: 240 seconds]
sevvie has quit [Ping timeout: 246 seconds]
davidhq has quit [Quit: My MacBook Pro has gone to sleep. ZZZzzz…]
Qladstone has joined #ruby
<Qladstone> hello!
<Qladstone> If I wanted to scan through a string of characters but instead of character by characters, I want to scan blocks of say 5 characters at a time, how would I do it?
sinkensabe has joined #ruby
zorak8 has quit [Quit: Leaving]
<havenn> >> "If I wanted to scan".each_char.each_slice(5).map &:join
<eval-in_> havenn => ["If I ", "wante", "d to ", "scan"] (https://eval.in/297267)
davedev2_ has joined #ruby
RegulationD has quit [Ping timeout: 250 seconds]
davedev24_ has quit [Ping timeout: 245 seconds]
RegulationD has joined #ruby
commmmodo has quit [Quit: commmmodo]
<Qladstone> hmm let me try it
gccostabr has joined #ruby
<havenn> >> "If I wanted to scan".scan /.{1,5}/
<eval-in_> havenn => ["If I ", "wante", "d to ", "scan"] (https://eval.in/297273)
sevvie has joined #ruby
<havenn> Qladstone: Another way is to use Regexp. ^
G has joined #ruby
iamjarvo has joined #ruby
<Qladstone> hmm
sinkensabe has quit [Ping timeout: 240 seconds]
Guest123 has quit [Quit: My MacBook Pro has gone to sleep. ZZZzzz…]
<Qladstone> how many slots are there in a hash for Ruby?
fgo has joined #ruby
<Qladstone> I don't know the correct term -.-
<Qladstone> but from what I understand
<Qladstone> there's a finite set of locations a hashtable can store key-value pairs
<shevy> Qladstone I guess the memory constraints the amount
RegulationD has quit [Ping timeout: 246 seconds]
<shevy> and the larger a hash becomes, the more unwieldy or however you say it may become
<Qladstone> I mean, I'm trying to come up with an estimate of how many key-value pairs can be stored in a hashtable before significant collisions start to occur
<pontiki> i'm confused
<pontiki> i didn't think a ruby Hash had anything to do with a hashtable
Qladstone has quit [Remote host closed the connection]
fgo has quit [Ping timeout: 245 seconds]
Qladstone has joined #ruby
<shevy> Qladstone how many keys does your biggest hash have yet
<bricker> eam: git bisect checks if your initial "good" commit is an ancestor of your initial "bad" commit, and fails if not, so you can only go from good -> bad
Qladstone has quit [Remote host closed the connection]
Qladstone has joined #ruby
<Qladstone> sorry I disconnected
<Qladstone> sorry I disconnected
<Qladstone> I can let it have as many keys as I want haha
<Qladstone> 48**n
<Qladstone> n is a decision to make
<shevy> wtf
<shevy> what are you storing
<shevy> the world?
<shevy> go and write a test until you break it
<shevy> hash = Hash.new
<Qladstone> all permutations of a character string -.-
<shevy> now fill it
<shevy> start!
teddyp1cker has joined #ruby
teddyp1cker has quit [Read error: Connection reset by peer]
teddyp1cker has joined #ruby
sevvie has quit [Ping timeout: 255 seconds]
<Qladstone> I'll try it later
sevvie has joined #ruby
Qladstone has quit [Remote host closed the connection]
rippa has joined #ruby
<pontiki> damn
<pontiki> especially if those permuted strings are going to be the hash keys
bricker has quit [Quit: leaving]
Crazy_Atheist has quit [Ping timeout: 246 seconds]
plutonic has joined #ruby
sdothum has quit [Quit: ZNC - 1.6.0 - http://znc.in]
zachrab has joined #ruby
Crazy_Atheist has joined #ruby
lemur has joined #ruby
davedev2_ has quit []
Yzguy has joined #ruby
zachrab has quit [Ping timeout: 255 seconds]
<eam> bricker: so invert the test?
teddyp1cker has quit [Remote host closed the connection]
Yzguy has quit [Client Quit]
dfinninger has joined #ruby
plutonic has quit [Quit: plutonic]
dandaman has joined #ruby
Channel6 has quit [Quit: Leaving]
teddyp1cker has joined #ruby
dfinninger has quit [Ping timeout: 246 seconds]
nii2361 has joined #ruby
lxsameer has joined #ruby
Hobogrammer has joined #ruby
Zesty has joined #ruby
Wolland has joined #ruby
steffes has joined #ruby
Wolland has quit [Client Quit]
ebbflowgo has quit [Read error: Connection reset by peer]
ebbflowgo has joined #ruby
kevr has quit [Quit: ZNC - http://znc.in]
Zesty has quit [Quit: Leaving...]
dandaman has quit [Quit: Leaving.]
nii2361 has quit [Ping timeout: 265 seconds]
dandaman has joined #ruby
sinkensabe has joined #ruby
teddyp1cker has quit [Remote host closed the connection]
armyriad has quit [Ping timeout: 265 seconds]
Hirzu has joined #ruby
armyriad has joined #ruby
sinkensabe has quit [Ping timeout: 264 seconds]
fgo has joined #ruby
ducklobster has joined #ruby
Guest123 has joined #ruby
Limix has quit [Quit: Limix]
Hirzu has quit [Ping timeout: 256 seconds]
TheNet has quit [Read error: Connection reset by peer]
armyriad has quit [Ping timeout: 240 seconds]
TheNet has joined #ruby
TheNet has quit [Remote host closed the connection]
armyriad has joined #ruby
morenoh149 has quit [Ping timeout: 252 seconds]
fgo has quit [Ping timeout: 246 seconds]
TheNet has joined #ruby
claw has quit [Ping timeout: 240 seconds]
teddyp1cker has joined #ruby
tearan has joined #ruby
rjo_ has joined #ruby
amundj has quit [Quit: My MacBook Pro has gone to sleep. ZZZzzz…]
riotjones has joined #ruby
claw has joined #ruby
skj3gg has joined #ruby
frog|OFF is now known as green-big-frog
<pontiki> require 'stringio'
martinbmadsen has joined #ruby
<pontiki> not 'StringIo'
riotjones has quit [Ping timeout: 256 seconds]
<skj3gg> sorry, kinda noob question but trying to make a generated static error page using my applications layout is there a way i can use views/layouts/application.html.haml from assets/html/404.html.haml
Guest123 has quit [Quit: Textual IRC Client: www.textualapp.com]
teddyp1cker has quit [Remote host closed the connection]
josiah14 has quit [Ping timeout: 246 seconds]
<rjo_> the require is not the problem
<rjo_> its the Rubinius reference
<rjo_> ive had two cocktails so please to pardon the capitalization error
lkba has quit [Ping timeout: 255 seconds]
martinbmadsen has quit [Ping timeout: 245 seconds]
charliesome has joined #ruby
Limix has joined #ruby
hvxgr has quit [Ping timeout: 244 seconds]
red_horned_rihno has quit [Ping timeout: 246 seconds]
dfinninger has joined #ruby
chipotle has joined #ruby
jottr has quit [Ping timeout: 256 seconds]
rkgudboy has joined #ruby
Limix has quit [Quit: Limix]
agent_snooze is now known as agent_white
jonr22 has joined #ruby
dfinninger has quit [Ping timeout: 246 seconds]
piotrj_ has quit [Read error: Connection reset by peer]
piotrj has joined #ruby
jonr22 has quit [Ping timeout: 265 seconds]
rkgudboy has quit [Ping timeout: 264 seconds]
Mon_Ouie has joined #ruby
iwaffles has joined #ruby
CorySimmons has joined #ruby
CorySimmons has quit [Max SendQ exceeded]
CorySimmons has joined #ruby
RegulationD has joined #ruby
red_horned_rihno has joined #ruby
amclain has quit [Quit: Leaving]
agrinb has quit [Remote host closed the connection]
agrinb has joined #ruby
RegulationD has quit [Ping timeout: 246 seconds]
DerisiveLogic has quit [Remote host closed the connection]
DerisiveLogic has joined #ruby
dandaman has quit [Quit: Leaving.]
sevenseacat has joined #ruby
iamjarvo has quit [Quit: My MacBook has gone to sleep. ZZZzzz…]
nii2361 has joined #ruby
agrinb has quit [Ping timeout: 256 seconds]
a5i has quit [Quit: Connection closed for inactivity]
pragmatism has joined #ruby
nii2361 has quit [Ping timeout: 244 seconds]
mostlybadfly has quit [Quit: Connection closed for inactivity]
rjo_ has left #ruby [#ruby]
piotrj has quit [Remote host closed the connection]
hvxgr has joined #ruby
User458764 has joined #ruby
arup_r has joined #ruby
pragmatism has quit [Quit: Textual IRC Client: www.textualapp.com]
greenbagels_ has joined #ruby
DEA7TH has joined #ruby
dseitz has quit [Quit: Textual IRC Client: www.textualapp.com]
mighty_gorilla has joined #ruby
mighty_gorilla has quit [Client Quit]
_hollywood has joined #ruby
DEA7TH has quit [Changing host]
DEA7TH has joined #ruby
greenbagels has quit [Ping timeout: 255 seconds]
TheNet has quit [Quit: Leaving...]
commmmodo has joined #ruby
DerisiveLogic has quit [Ping timeout: 264 seconds]
zachrab has joined #ruby
mroach has quit [Quit: mroach]
zachrab has quit [Ping timeout: 240 seconds]
Qladstone has joined #ruby
Qladstone has quit [Remote host closed the connection]
iwaffles has quit [Quit: iwaffles]
CorySimmons has quit [Quit: Bye!]
bruno- has joined #ruby
bruno- is now known as Guest51191
CorySimmons has joined #ruby
CorySimmons has quit [Client Quit]
claw has quit [Ping timeout: 244 seconds]
yfeldblu_ has joined #ruby
toretore has joined #ruby
claw has joined #ruby
piotrj has joined #ruby
Guest51191 has quit [Ping timeout: 255 seconds]
claptor has quit [Quit: this channel is bakas]
yfeldblum has quit [Ping timeout: 255 seconds]
Qladstone has joined #ruby
CorySimmons has joined #ruby
Hirzu has joined #ruby
CorySimmons has quit [Max SendQ exceeded]
CorySimmons has joined #ruby
CorySimmons has quit [Client Quit]
piotrj has quit [Remote host closed the connection]
dfinninger has joined #ruby
_5kg has quit [Ping timeout: 264 seconds]
Hirzu has quit [Ping timeout: 252 seconds]
charliesome has quit [Quit: zzz]
tearan has quit [Ping timeout: 256 seconds]
Asher has joined #ruby
LJT has quit [Quit: Sleeping...]
nii2361 has joined #ruby
charliesome has joined #ruby
dfinninger has quit [Ping timeout: 252 seconds]
Takle has joined #ruby
skj3gg has quit [Quit: ZZZzzz…]
teddyp1cker has joined #ruby
Takle has quit [Ping timeout: 264 seconds]
fgo has joined #ruby
morenoh149 has joined #ruby
RegulationD has joined #ruby
pontiki has quit [Quit: nini]
digitalextremist has joined #ruby
fgo has quit [Ping timeout: 245 seconds]
RegulationD has quit [Ping timeout: 245 seconds]
RegulationD has joined #ruby
AlexRussia has quit [Ping timeout: 264 seconds]
mrdtt has joined #ruby
apeiros_ has quit [Read error: Connection reset by peer]
RegulationD has quit [Ping timeout: 246 seconds]
vdamewood has joined #ruby
apeiros_ has joined #ruby
Takle has joined #ruby
piotrj has joined #ruby
spicymagpie has joined #ruby
AlexRussia has joined #ruby
martinbmadsen has joined #ruby
jcdesimp has quit [Quit: Leaving...]
wldcordeiro has quit [Ping timeout: 265 seconds]
lemur has quit [Remote host closed the connection]
Takle has quit [Ping timeout: 246 seconds]
ptrrr has joined #ruby
spicymagpie is now known as SpicyMagpie
rkgudboy has joined #ruby
martinbmadsen has quit [Ping timeout: 252 seconds]
Pupeno has joined #ruby
apeiros_ has quit [Remote host closed the connection]
greenbagels_ has quit [Ping timeout: 256 seconds]
apeiros_ has joined #ruby
Takle has joined #ruby
maplesyrup has quit [Quit: WeeChat 1.0]
green-big-frog is now known as frog|OFF
grr has joined #ruby
piotrj has quit [Remote host closed the connection]
michael_mbp has quit [Excess Flood]
michael_mbp has joined #ruby
piotrj has joined #ruby
apeiros_ has quit [Ping timeout: 250 seconds]
_5kg has joined #ruby
User458764 has quit [Quit: My iMac has gone to sleep. ZZZzzz…]
oo_ has joined #ruby
jenrzzz has joined #ruby
rkgudboy has quit [Ping timeout: 246 seconds]
toretore has quit [Quit: This computer has gone to sleep]
jonr22 has joined #ruby
piotrj has quit [Remote host closed the connection]
piotrj has joined #ruby
randiman has joined #ruby
tkuchiki has joined #ruby
jonr22 has quit [Ping timeout: 256 seconds]
agrinb has joined #ruby
dfinninger has joined #ruby
steffes has quit [Remote host closed the connection]
apeiros_ has joined #ruby
sigurding has joined #ruby
livingstn has quit []
commmmodo has quit [Quit: commmmodo]
agrinb has quit [Ping timeout: 265 seconds]
dfinninger has quit [Ping timeout: 252 seconds]
Abhijit_ has joined #ruby
Abhijit_ is now known as Abhijit
tag has quit [Changing host]
tag has joined #ruby
piotrj has quit [Remote host closed the connection]
piotrj has joined #ruby
riotjones has joined #ruby
digitalextremist has quit [Read error: Connection reset by peer]
charliesome has quit [Quit: zzz]
fgo has joined #ruby
digitalextremist has joined #ruby
User458764 has joined #ruby
riotjones has quit [Ping timeout: 246 seconds]
multi_io_ has joined #ruby
wicope has joined #ruby
grr has quit [Read error: Connection reset by peer]
fgo has quit [Ping timeout: 252 seconds]
<shevy> ruby -run -ehttpd . -p 3000
<shevy> I am confused
<shevy> this is not webrick?
multi_io has quit [Ping timeout: 252 seconds]
<apeiros_> shevy: -run = -r un = require 'un'
<apeiros_> so whatever un.rb defines as `def http`
<shevy> aha
<shevy> s = WEBrick::HTTPServer.new(options)
<shevy> indeed. it spawns some webrick
charliesome has joined #ruby
AlexRussia has quit [Ping timeout: 245 seconds]
Dolphi has joined #ruby
AlexRussia has joined #ruby
zachrab has joined #ruby
SouL has joined #ruby
apeiros_ has quit [Read error: Connection reset by peer]
apeiros_ has joined #ruby
ndrei has quit [Ping timeout: 245 seconds]
User458764 has quit [Quit: My iMac has gone to sleep. ZZZzzz…]
BTRE has quit [Ping timeout: 246 seconds]
ndrei has joined #ruby
bruno- has joined #ruby
zachrab has quit [Ping timeout: 245 seconds]
User458764 has joined #ruby
Hirzu has joined #ruby
dopiee has joined #ruby
SouL has quit [Ping timeout: 264 seconds]
martinbmadsen has joined #ruby
drPoggs has joined #ruby
dopie has quit [Ping timeout: 255 seconds]
BTRE has joined #ruby
AlexRussia has quit [Ping timeout: 240 seconds]
bluOxigen has joined #ruby
teddyp1cker has quit [Remote host closed the connection]
tkuchiki has quit [Remote host closed the connection]
martinbmadsen has quit [Ping timeout: 256 seconds]
_blizzy_ has quit [Quit: Leaving]
charliesome has quit [Quit: zzz]
spider-mario has joined #ruby
piotrj has quit [Remote host closed the connection]
piotrj has joined #ruby
piotrj has quit [Remote host closed the connection]
piotrj has joined #ruby
grr_ has joined #ruby
Joufflu has quit [Quit: Peace]
rkgudboy has joined #ruby
agrinb has joined #ruby
Soda has joined #ruby
blackmesa has joined #ruby
_Andres has joined #ruby
agrinb has quit [Ping timeout: 265 seconds]
sivsushruth has joined #ruby
dh64 has joined #ruby
dfinninger has joined #ruby
nii2361 has quit [Ping timeout: 252 seconds]
havenn has quit [Remote host closed the connection]
commmmodo has joined #ruby
dfinninger has quit [Ping timeout: 240 seconds]
asmodlol has joined #ruby
RegulationD has joined #ruby
<arup_r> >> [1,2].reduce :+
<eval-in_> arup_r => 3 (https://eval.in/297371)
<arup_r> cool.. why not ? :(
<arup_r> >> ("a".."z").reduce(&("".method(:<<)))
riotjones has joined #ruby
<eval-in_> arup_r => wrong number of arguments (2 for 1) (ArgumentError) ... (https://eval.in/297372)
<arup_r> >> ("a".."z").reduce(&"".method(:<<))
<eval-in_> arup_r => wrong number of arguments (2 for 1) (ArgumentError) ... (https://eval.in/297373)
User458764 has quit [Quit: My iMac has gone to sleep. ZZZzzz…]
<arup_r> Ahh! Ruby is so slow to run the bad code.. :p
RegulationD has quit [Ping timeout: 246 seconds]
fgo has joined #ruby
RegulationD has joined #ruby
_5kg has quit [Ping timeout: 264 seconds]
lordkryss has joined #ruby
sivsushruth has quit [Ping timeout: 250 seconds]
commmmodo has quit [Quit: commmmodo]
serivich has joined #ruby
riotjones has quit [Ping timeout: 245 seconds]
rkgudboy has quit [Ping timeout: 252 seconds]
RegulationD has quit [Ping timeout: 246 seconds]
randiman has quit [Quit: (null)]
fgo has quit [Ping timeout: 250 seconds]
rkgudboy has joined #ruby
destructure has quit [Ping timeout: 252 seconds]
<hanmac> arup_r:
<hanmac> >> x="";("a".."z").each(&x.method(:<<)); x
<eval-in_> hanmac => "abcdefghijklmnopqrstuvwxyz" (https://eval.in/297374)
stormchaser30000 has joined #ruby
RegulationD has joined #ruby
stormchaser30000 has quit [Quit: http://www.kiwiirc.com/ - A hand crafted IRC client]
charliesome has joined #ruby
<godd2> >> [*"a".."z"].join
<eval-in_> godd2 => "abcdefghijklmnopqrstuvwxyz" (https://eval.in/297375)
apeiros_ has quit []
sinkensabe has joined #ruby
RegulationD has quit [Ping timeout: 244 seconds]
Stalkr_ has joined #ruby
mikecmpbll has joined #ruby
rkgudboy has quit [Ping timeout: 256 seconds]
sinkensabe has quit [Ping timeout: 240 seconds]
grr_ has quit [Remote host closed the connection]
kadoppe has joined #ruby
oki has joined #ruby
teddyp1cker has joined #ruby
The_Phoenix has joined #ruby
OrbitalKitten has joined #ruby
frog|OFF is now known as green-big-frog
mrdtt has quit [Quit: Textual IRC Client: www.textualapp.com]
SpicyMagpie has quit [Ping timeout: 255 seconds]
steffes has joined #ruby
kadoppe has quit [Quit: WeeChat 0.4.3]
martinbmadsen has joined #ruby
OrbitalKitten has quit [Client Quit]
jonr22 has joined #ruby
steffes has quit [Ping timeout: 264 seconds]
martinbmadsen has quit [Ping timeout: 264 seconds]
jonr22 has quit [Ping timeout: 252 seconds]
<shevy> hanmac codes in smileys
Abhijit has quit [Quit: Bye.]
<godd2> (b'_')b
steffes has joined #ruby
AlexRussia has joined #ruby
buub has joined #ruby
blueOxigen has joined #ruby
agrinb has joined #ruby
serivich has quit [Ping timeout: 252 seconds]
bluOxigen has quit [Ping timeout: 252 seconds]
steffes has quit [Ping timeout: 250 seconds]
tobacco_joe has joined #ruby
agrinb has quit [Ping timeout: 265 seconds]
teddyp1cker has quit [Remote host closed the connection]
teddyp1cker has joined #ruby
dj_zubehoer has joined #ruby
OrbitalKitten has joined #ruby
AlexRussia has quit [Ping timeout: 246 seconds]
_5kg has joined #ruby
sigurding has quit [Quit: sigurding]
keen__________82 has joined #ruby
teddyp1cker has quit [Ping timeout: 256 seconds]
keen__________81 has quit [Ping timeout: 264 seconds]
dfinninger has joined #ruby
AlexRussia has joined #ruby
alvaro_o_ has joined #ruby
sivsushruth has joined #ruby
Stalkr_ has quit [Quit: Leaving...]
alvaro_o_ has quit [Client Quit]
Soda has quit [Remote host closed the connection]
rikai has quit [Ping timeout: 264 seconds]
pen has quit []
User458764 has joined #ruby
dfinninger has quit [Ping timeout: 244 seconds]
chipotle has quit [Quit: cheerio]
LJT has joined #ruby
plashchynski has joined #ruby
zachrab has joined #ruby
plashchynski has quit [Client Quit]
sigurding has joined #ruby
Qladstone has quit [Remote host closed the connection]
User458764 has quit [Quit: My iMac has gone to sleep. ZZZzzz…]
zachrab has quit [Ping timeout: 240 seconds]
Mia has joined #ruby
Mia has quit [Changing host]
Mia has joined #ruby
Axy has quit [Ping timeout: 244 seconds]
BuGo has quit [Quit: Lost terminal]
Takumo has joined #ruby
Takumo has quit [Changing host]
Takumo has joined #ruby
zapata has joined #ruby
justin_pdx has joined #ruby
justin_pdx has quit [Client Quit]
sigurding has quit [Quit: sigurding]
User458764 has joined #ruby
ragingcake_ has joined #ruby
hs366 has joined #ruby
Dolphi has quit [Ping timeout: 272 seconds]
ValicekB has quit [Ping timeout: 240 seconds]
xrlabs has quit [Ping timeout: 264 seconds]
postmodern has quit [Quit: Leaving]
fgo has joined #ruby
sevenseacat has quit [Ping timeout: 256 seconds]
rikai has joined #ruby
rikai has quit [Remote host closed the connection]
mikecmpbll has quit [Read error: Connection reset by peer]
rikai has joined #ruby
ValicekB has joined #ruby
sevenseacat has joined #ruby
mikecmpbll has joined #ruby
agrinb has joined #ruby
<tobacco_joe> does anyone have experience with dnsruby and dynamic dns updates?
thebastl has joined #ruby
<tobacco_joe> it seems like dnsruby isn't signing my queries
asmodlol has quit [Ping timeout: 246 seconds]
xrlabs has joined #ruby
pandaant has joined #ruby
agrinb has quit [Ping timeout: 265 seconds]
asmodlol has joined #ruby
phale has joined #ruby
<mhenrixon> So 2.2.1 is broken on ubuntu 14.04?
mikecmpbll has quit [Read error: Connection reset by peer]
mikecmpbll has joined #ruby
<phale> mhenrixon: ubuntu is broken
fgo has quit [Ping timeout: 245 seconds]
<mhenrixon> phale ok so https://redmine.ruby-lang.org/issues/10920 isn't the ruby source being broken?
<phale> mhenrixon: your issue is rejected
<phale> try Revision 49017
Hirzu has quit [Remote host closed the connection]
<mhenrixon> phale its not my issue and a new one on the same topic was created in https://bugs.ruby-lang.org/issues/10934
mikecmpbll has quit [Read error: Connection reset by peer]
<phale> well that's what you get for using ubuntu
<phale> i am unable to help you
<phale> you can probably talk on #ubuntu, they'll know what to do
oki has quit [Ping timeout: 250 seconds]
mikecmpbll has joined #ruby
m8 has joined #ruby
<shevy> mhenrixon does ubuntu have 2.2.1?
riotjones has joined #ruby
<mhenrixon> shevy using rbenv
<mhenrixon> and ruby build
Rephiax has quit []
<shevy> ok so it has nothing to do with ubuntu
Qladstone has joined #ruby
dfinninger has joined #ruby
<shevy> I am using ruby 2.2.1p85 (2015-02-26 revision 49769) [i686-linux]
<phale> use rvm
<shevy> the bug report you showed, that's for windows or? [x64-mswin64_120]
<mhenrixon> same problem for ubuntu shevy https://github.com/sstephenson/ruby-build/issues/728
<phale> LoadErroe
<phale> i'm not sure if that's a typo or someone literally gets that
<shevy> that is a typo
steffes has joined #ruby
<shevy> tool/rbinstall.rb
riotjones has quit [Ping timeout: 264 seconds]
thebastl has quit [Read error: Connection reset by peer]
<shevy> on line 714 haha
<shevy> my ruby also has this error :D
dfinninger has quit [Ping timeout: 245 seconds]
_hollywood has quit [Quit: Leaving]
thebastl has joined #ruby
kadoppe has joined #ruby
RegulationD has joined #ruby
asmodlol has quit [Ping timeout: 272 seconds]
steffes has quit [Ping timeout: 250 seconds]
asmodlol has joined #ruby
digitalextremist has quit [Ping timeout: 250 seconds]
aspiers has quit [Ping timeout: 265 seconds]
iml has quit [Quit: Connection closed for inactivity]
RegulationD has quit [Ping timeout: 245 seconds]
corehook has joined #ruby
<atmosx> hello ppl
<phale> hello a C programmer is fighting me
<phale> what do I do
art-solopov has joined #ruby
RegulationD has joined #ruby
<jhass> phale: fighting in what way?
<atmosx> phale: ask him to write a web application, without memormy leaks for once.
RandyT has quit [Ping timeout: 272 seconds]
<phale> jhass: he's telling me that i haven't done any real programming and that ruby programmers also don't do real programming
<phale> apparently we like to talk about "penis"
<phale> im not joking
<phale> 13:00 < zyxwvuts> that's because you'd rather bitch all day about which language you perceive to have a larger penis, than do any actual programming
multi_io_ is now known as multi_io
<atmosx> phale: okay that's a real life advice, don't lose time with idiots.
User458764 has quit [Quit: My iMac has gone to sleep. ZZZzzz…]
<jhass> ^ * 10**6
<atmosx> phale: they are nearly infinite and can be found everywhere online. He could be trolling you though, I do that all too often online (when time permits and moods are properly adjusted).
_hollywood has joined #ruby
<phale> i thought he was serious
<jhass> that's your only fault
<atmosx> jhass: could you look at this? It's some CSS thing going wrong, it's subtle but it bothers me nevertheless http://atmosx.clarify-it.com/d/vv4r2v
<atmosx> at #css everyone is dead apparently
<shevy> phale tell him to come here!
plashchynski has joined #ruby
RegulationD has quit [Ping timeout: 245 seconds]
Jackneill has joined #ruby
Qladstone has quit []
<jhass> atmosx: we're not in #css and I can't be bothered to clone that gist :P
zyxwvuts has joined #ruby
last_staff has joined #ruby
<atmosx> clone? ah no, I hoped you'd be able to read the code and spot a possible fix on the fly :-P
<atmosx> anyway I'll continue trial-and-error.
<jhass> way too backend oriented, I can figure that stuff out with the dev tools usually, but it's not my daily bread & butter ;)
RegulationD has joined #ruby
<atmosx> jhass: well, I don't like it either and it's become more and more demanding to make something that doesn't suck in css/html.
<atmosx> I was going to make this app in meteor but I don't have time :-( ... I need something working by the end of the day and the hardest part is the CSS lol. Anywya... bbl
<jhass> atmosx: something like http://dabblet.com/ is nice for sharing such stuff btw
FooMunki_ has joined #ruby
<atmosx> jhass: hmm looks cool
zyxwvuts has left #ruby [#ruby]
RegulationD has quit [Ping timeout: 265 seconds]
sinkensabe has joined #ruby
<atmosx> hanmac: found-it
ypasmk has joined #ruby
<atmosx> hm, but I'm not sure what's the proper way to handle this there's a margin-bottom: 1px; property inherited. If I zero this in the custom.css it doesn't work.
<atmosx> shit.
<atmosx> hm maybe hard-coded to haml
* atmosx goes to try
<atmosx> hanmac: cool gif btw.
jonr22 has joined #ruby
oo_ has quit [Remote host closed the connection]
<atmosx> okay I made it.
* atmosx is a ninja.
<phale> shevy
sinkensabe has quit [Ping timeout: 255 seconds]
<phale> zyxwvuts said if you want to talk to him you gotta come on his channel
<jhass> atmosx: you know CSS specificity?
<jhass> very useful
<atmosx> jhass: I know it's a mess actually.
nii2361 has joined #ruby
stef204 has joined #ruby
ragingcake_ has quit [Quit: ragingcake_]
jonr22 has quit [Ping timeout: 246 seconds]
* atmosx sting - shape of my heart
fgo has joined #ruby
jeromelanteri has quit [Quit: KVIrc 4.2.0 Equilibrium http://www.kvirc.net/]
mostlybadfly has joined #ruby
agrinb has joined #ruby
Darryl___ has joined #ruby
nii2361 has quit [Ping timeout: 250 seconds]
ypasmk has quit [Quit: ypasmk]
serivich has joined #ruby
agrinb has quit [Ping timeout: 246 seconds]
mattwildig has joined #ruby
Timba-as has joined #ruby
sivsushruth has quit [Read error: Connection reset by peer]
sivsushruth has joined #ruby
User458764 has joined #ruby
_cake has joined #ruby
yfeldblu_ has quit [Ping timeout: 256 seconds]
maximski has joined #ruby
<shevy> phale why would I want to talk to him, he should come here
<phale> he did
<phale> then he left
pork_clips has quit [Ping timeout: 264 seconds]
maximski has quit [Max SendQ exceeded]
<shevy> aha. I don't have channel time stamps nor do I see who joins or left, I only see people who are chatting
<shevy> and I wasn't before my computer for a while!
<shevy> phale did you improve on your gem?
<phale> yeah
maximski has joined #ruby
<shevy> good!
<phale> i removed the examples
<shevy> time to move to your second gem
<shevy> omg
<phale> they were too long
<phale> it made my code roughly 59 lines for no reason
<shevy> we call that a "regression"
ragingcake has joined #ruby
Deele has joined #ruby
sankaber has joined #ruby
<phale> okay
teddyp1cker has joined #ruby
Hirzu has joined #ruby
sivsushruth has quit [Ping timeout: 256 seconds]
red_horned_rihno has quit [Remote host closed the connection]
sivsushruth has joined #ruby
User458764 has quit [Quit: My iMac has gone to sleep. ZZZzzz…]
kirun has joined #ruby
mattwildig has quit []
<shevy> well move to another project
arup_r has quit [Quit: ChatZilla 0.9.91.1 [Firefox 36.0/2015022000]]
<shevy> phale which one will it be?
<phale> i have no idea
roolo has joined #ruby
<phale> hm
<phale> redditor
<phale> reddit API thing
teddyp1cker has quit [Ping timeout: 252 seconds]
Hirzu has quit [Ping timeout: 240 seconds]
[gmi] has joined #ruby
BLuEGoD has joined #ruby
dfinninger has joined #ruby
vdamewood has quit [Quit: ["Textual IRC Client: www.textualapp.com"]]
zachrab has joined #ruby
sivsushruth has quit [Ping timeout: 252 seconds]
sivsushruth has joined #ruby
Feyn has quit [Quit: Leaving]
dfinninger has quit [Ping timeout: 264 seconds]
nfk has joined #ruby
devFrederick has quit [Ping timeout: 246 seconds]
zachrab has quit [Ping timeout: 246 seconds]
sivsushruth has quit [Ping timeout: 256 seconds]
sivsushruth has joined #ruby
tokik has quit [Ping timeout: 244 seconds]
tokik has joined #ruby
User458764 has joined #ruby
justinweiss has quit [Quit: WeeChat 0.4.2]
dj_zubehoer has quit [Remote host closed the connection]
dj_zubehoer has joined #ruby
dj_zubehoer has quit [Remote host closed the connection]
blackmesa has quit [Ping timeout: 245 seconds]
thebastl has quit [Remote host closed the connection]
leslie has joined #ruby
leslie has joined #ruby
yvemath has joined #ruby
plashchynski has quit [Quit: plashchynski]
sivsushruth has quit [Ping timeout: 264 seconds]
plashchynski has joined #ruby
sivsushruth has joined #ruby
caveat- has joined #ruby
sinkensabe has joined #ruby
jenrzzz has quit [Ping timeout: 240 seconds]
alexherbo2 has quit [Quit: WeeChat 1.1.1]
User458764 has quit [Quit: My iMac has gone to sleep. ZZZzzz…]
sivsushruth has quit [Ping timeout: 264 seconds]
alexherbo2 has joined #ruby
alexherbo2 has quit [Client Quit]
alexherbo2 has joined #ruby
sivsushruth has joined #ruby
agrinb has joined #ruby
oo_ has joined #ruby
sinkensabe has quit [Ping timeout: 250 seconds]
Megtastique has joined #ruby
steffes has joined #ruby
jottr has joined #ruby
agrinb has quit [Ping timeout: 265 seconds]
Aswebb_ has joined #ruby
oo_ has quit [Ping timeout: 246 seconds]
steffes has quit [Ping timeout: 252 seconds]
sivsushruth has quit [Ping timeout: 250 seconds]
codecop has joined #ruby
sivsushruth has joined #ruby
Sirupsen has joined #ruby
asmodlol has quit [Ping timeout: 245 seconds]
sivsushruth has quit [Ping timeout: 256 seconds]
FooMunki_ has quit [Quit: FooMunki_]
corehook_ has joined #ruby
sivsushruth has joined #ruby
asmodlol has joined #ruby
corehook has quit [Ping timeout: 245 seconds]
corehook has joined #ruby
CustosLimen has joined #ruby
User458764 has joined #ruby
agrinb has joined #ruby
lkba has joined #ruby
blackmesa has joined #ruby
corehook_ has quit [Ping timeout: 245 seconds]
FooMunki_ has joined #ruby
RandyT has joined #ruby
pontiki has joined #ruby
<pontiki> o/
<phale> |
<phale> /\
<pontiki> \o/
<phale> |
<phale> |
<phale> |
agrinb has quit [Ping timeout: 265 seconds]
<pontiki> ||
<pontiki> up up and away
<phale> :DD
Hirzu has joined #ruby
morenoh149 has quit [Ping timeout: 240 seconds]
sdothum has joined #ruby
<shevy> omg
Hirzu has quit [Ping timeout: 250 seconds]
davidhq has joined #ruby
last_staff has quit [Quit: last_staff]
blackmesa has quit [Ping timeout: 246 seconds]
<phale> what is a toy programming language?
dfinninger has joined #ruby
<shevy> don't know
green-big-frog is now known as frog|OFF
<phale> my friend says anything with OOP is a toy
<shevy> something you can have fun with while coding
<shevy> yeah your java buddy is a real stinker
<phale> it's zyxwvuts..
doodlehaus has joined #ruby
<shevy> yeah
<shevy> a stinker
<phale> shevy: I want to extend the string class
<phale> how do I do that
<phale> just to add a few methods
<shevy> didn't you write your own class already
<shevy> so you must know how you can extend something
<shevy> class Foo
<shevy> end
<shevy> class Foo
<shevy> end
<phale> oh
<shevy> ^^^ there you go. you extended class Foo
<phale> ty ;)
<shevy> and it's the same with class String too
sankaber has quit [Quit: My Mac has gone to sleep. ZZZzzz…]
<shevy> I am watching a lecture about soil chemistry... this is so boring :(
apeiros_ has joined #ruby
dtordable has joined #ruby
<phale> wait so
<phale> "".method_call
<phale> how do I get the ""
<phale> self?
<jhass> phale: have a very good reason to include core extensions into a gem though, consider having a helper instead
<jhass> yes, self
bluOxigen has joined #ruby
dfinninger has quit [Ping timeout: 264 seconds]
<jhass> note you only need for for things like String#[] though
RegulationD has joined #ruby
<shevy> for for four things
<phale> yea
<shevy> you can also use replace() inside class String
kith has quit [Ping timeout: 246 seconds]
<shevy> >> class String; def yo; replace '42'; end; end; x = 'abc'; x.yo;x
<eval-in_> shevy => "42" (https://eval.in/297447)
blueOxigen has quit [Ping timeout: 244 seconds]
<phale> if you want to know what i'm making
<phale> it's a palindrome library
<phale> self.reverse == self
asmodlol has quit [Ping timeout: 255 seconds]
<shevy> yeah
<shevy> find all palindromes
<shevy> ATCTAGATTACATAGGCCAAAACCGATAGACCCA
<shevy> TAGATCTAATGTATCCGGTTTTGGCTATCTGGGT
<phale> could make that too yeah
<shevy> transcription factors that bind to DNA are usually palindromic
JStoker has quit [Remote host closed the connection]
scpike has quit [Remote host closed the connection]
<phale> my program will create palindromes
<phale> too
RegulationD has quit [Ping timeout: 244 seconds]
otisZart has joined #ruby
RegulationD has joined #ruby
asmodlol has joined #ruby
dtordable has quit [Ping timeout: 256 seconds]
<phale> confusing
dtordable has joined #ruby
jottr has quit [Ping timeout: 255 seconds]
lolmaus has quit [Quit: Konversation terminated!]
<pontiki> radiation-hardened palindromic quines?
dj_zubehoer has joined #ruby
Takle has quit [Remote host closed the connection]
jonr22 has joined #ruby
RegulationD has quit [Ping timeout: 244 seconds]
serivichi has joined #ruby
<phale> a butt tuba
RegulationD has joined #ruby
<pontiki> someone is have too much fun with their vuvuzela?
serivich has quit [Ping timeout: 246 seconds]
dj_zubehoer has quit [Ping timeout: 246 seconds]
jonr22 has quit [Ping timeout: 246 seconds]
RegulationD has quit [Ping timeout: 246 seconds]
<phale> how do i generate palindromes
asmodlol has quit [Ping timeout: 256 seconds]
<jhass> s << s.reverse
maximski has quit []
sinkensabe has joined #ruby
<phale> thats all?
jonr22 has joined #ruby
asmodlol has joined #ruby
<jhass> it's wrong?
<phale> no
<phale> i meant something like with a level of difficulty
<phale> i.e "da"
<phale> could add a d at the end and it would be a palindrome
<jhass> yeah
<jhass> !g generating palindrome
<jhass> there probably are some linguists papers or so
sivsushruth has quit [Ping timeout: 256 seconds]
sivsushruth has joined #ruby
Alex-xd has joined #ruby
<Alex-xd> -d- I Like the Shit┌∩┐(◣_◢)┌∩┐
<jhass> Alex-xd: how's your ruby?
sinkensabe has quit [Ping timeout: 244 seconds]
<shevy> cool
<shevy> helpa can be used as a google aid
<shevy> !g ruby rules
<phale> his message shows as question marks for me
<shevy> yeah
<shevy> he uses some unicode I bet
<jhass> phale: need a better font then ;)
<phale> soncocy
<phale> ?
<jhass> noto
JStoker has joined #ruby
oo_ has joined #ruby
Takle has joined #ruby
rbennacer has joined #ruby
stef204 has quit [Ping timeout: 252 seconds]
mikecmpbll has quit [Quit: i've nodded off.]
oo_ has quit [Ping timeout: 252 seconds]
sevenseacat has quit [Remote host closed the connection]
davedev24_ has joined #ruby
<phale> i just realized that vim can edit websites too
IrishGringo has joined #ruby
dtordable has quit [Ping timeout: 250 seconds]
Stalkr_ has joined #ruby
sivsushruth has quit [Ping timeout: 246 seconds]
sivsushruth has joined #ruby
dtordable has joined #ruby
agrinb has joined #ruby
<phale> any way to include all methods from a class?
<phale> in another class
<shevy> phale that's what modules are for
<shevy> another way is to subclass
sivsushruth has quit [Ping timeout: 264 seconds]
Zai00 has joined #ruby
<phale> ok
<phale> how do i subclass
sivsushruth has joined #ruby
<jhass> phale: did you go through a basic ruby tutorial yet?
<jhass> anything more broad than tryruby.org will cover that
<phale> TRPL
<jhass> most certainly has a chapter about it
agrinb has quit [Ping timeout: 256 seconds]
asmodlol has quit [Ping timeout: 264 seconds]
jottr has joined #ruby
<jhass> we can give you the terms to look up (like mixins, subclasses, inheritance in this case), and we happily answer specific questions and look at edge cases with you, but we're not your personal tutors
xcesariox has joined #ruby
bradland has joined #ruby
asmodlol has joined #ruby
zachrab has joined #ruby
jottr has quit [Ping timeout: 240 seconds]
boshhead has joined #ruby
teddyp1cker has joined #ruby
sivsushruth has quit [Ping timeout: 256 seconds]
sivsushruth has joined #ruby
kaspergrubbe has joined #ruby
zachrab has quit [Ping timeout: 244 seconds]
davedev2_ has joined #ruby
steffes has joined #ruby
Zesty has joined #ruby
teddyp1cker has quit [Ping timeout: 245 seconds]
davedev24_ has quit [Ping timeout: 264 seconds]
jottr has joined #ruby
sivsushruth has quit [Ping timeout: 256 seconds]
sivsushruth has joined #ruby
User458764 has quit [Quit: My iMac has gone to sleep. ZZZzzz…]
enebo has joined #ruby
asmodlol has quit [Ping timeout: 272 seconds]
steffes has quit [Ping timeout: 246 seconds]
dfinninger has joined #ruby
asmodlol has joined #ruby
rbennacer has quit [Remote host closed the connection]
sivsushruth has quit [Ping timeout: 256 seconds]
sivsushruth has joined #ruby
stef204 has joined #ruby
corehook has quit []
fgo has quit [Ping timeout: 252 seconds]
centrx has joined #ruby
plashchynski has quit [Quit: plashchynski]
dfinninger has quit [Ping timeout: 272 seconds]
teddyp1cker has joined #ruby
Takle has quit [Remote host closed the connection]
plashchynski has joined #ruby
nii2361 has joined #ruby
tgunr has joined #ruby
lxsameer has quit [Quit: Leaving]
Stalkr_ has quit [Quit: Leaving...]
peterhu has quit [Quit: Lost terminal]
Takle has joined #ruby
matrixfox has quit [Remote host closed the connection]
Tarential has quit [Quit: Terminated with extreme prejudice - dircproxy 1.0.5]
Takle has quit [Remote host closed the connection]
Zesty has quit [Quit: Linkinus - http://linkinus.com]
sankaber has joined #ruby
<shevy> phale class Foo; end; class Bar < Foo; end
<shevy> phale if you wish to also call some method in the parent class but also your subclass, then you can use super() or super(arguments_here)
Darryl___ has quit [Quit: Connection closed for inactivity]
<shevy> phale but use a module, it's simpler
geefolk has joined #ruby
<shevy> >> module Foo; def yo; puts 'yo'; end; end; class Bar; include Foo; end; Bar.new.yo
<eval-in_> shevy => yo ... (https://eval.in/297452)
crodas has quit [Ping timeout: 272 seconds]
nii2361 has quit [Ping timeout: 256 seconds]
t_p has joined #ruby
rbennacer has joined #ruby
<bradland> needs moar factory
teddyp1cker has quit [Remote host closed the connection]
serivichi has quit [Ping timeout: 255 seconds]
<phale> i'm now going to parse BMP
<phale> then later i'll parse JPG, PNG, Tiff, Exif
User458764 has joined #ruby
<jhass> see ya next year then
<phale> :)
<phale> wait why
<jhass> you'll see
<phale> but it's easy to parse BMP
<jhass> probably
<bradland> the older the format, the more likely you are to have to deal with cruft
<phale> PPM was easy though
<phale> and im not sure if it's old
<bradland> cruft is the accumulation of hacks and workarounds for the iterative change of formats over time
* jhass remembers the PSP was hacked once through it's tiff library
<bradland> the number of times a format has been forced to iterate is relavant as well
<phale> so it's immensely hard?
<phale> it will take me 9 years to parse one format?
<bradland> is uint32 the same as unsigned long in C?
<phale> no
<bradland> phale: you should definitely give it a shot
<bradland> always try hard problems
<bradland> just to see what you get in to
<phale> i bet jpg is easier than bmp
xcesariox has quit [Quit: My MacBook Pro has gone to sleep. ZZZzzz…]
pontiki has quit [Ping timeout: 272 seconds]
<jhass> bradland: http://stackoverflow.com/a/589684/2199687 I think that was the most comprehensive one I found on the topic
<bradland> thx jhass
<phale> The C++ standard does not specify the size of integral types in bytes, but it specifies minimum ranges they must be able to hold.
<phale> lmao
<phale> yeah have fun with that
<bradland> yep, there it is: 4294967295 (unsigned long), 2^32
Azure has quit [Quit: My MBP went to sleep.]
Sirupsen has quit [Quit: My MacBook Pro has gone to sleep. ZZZzzz…]
<bradland> i'm not actually writing C. i'm looking for the C data type with a boundary at 4294967295.
<phale> you need to make your own one then
<bradland> what are you talking about?
<bradland> the upper bound of unsigned long is exactly the range i'm looking for.
<bradland> also, i'm talking about C, not C++
sivsushruth has quit [Ping timeout: 245 seconds]
thebastl has joined #ruby
<phale> trust me
<phale> i've coded in C for 5 years
<phale> i know what im talking about
<bradland> what's the upper boundary of unsigned long?
<phale> i have no idea
<phale> :(
dangerousdave has joined #ruby
<jhass> great show off of five years C experience
<bradland> that makes no sense to me
<jhass> I posted a linked, and you quoted from it, that explains it
<jhass> *a link
agrinb has joined #ruby
<bradland> yeah, thanks jhass. i'm just a little annoyed that phale keeps interjecting.
<bradland> i'll leave it alone. what you posted has the info i need.
<jhass> was talking to phale :)
<bradland> oh lol
pontiki has joined #ruby
teddyp1cker has joined #ruby
lyuben_ has joined #ruby
CorySimmons has joined #ruby
grr has joined #ruby
<phale> if you dont believe me
<bradland> phale, what are you even asserting?
<jhass> I don't follow what that should prove either
<phale> My immense knowledge!
doodlehaus has quit [Remote host closed the connection]
agrinb has quit [Ping timeout: 265 seconds]
Alex-xd has quit []
<bradland> are you asserting that the upper boundary of unsigned long is not 4294967295?
<bradland> i get it that they don't specify in bytes
n80 has joined #ruby
<phale> no
art-solopov has quit [Quit: Konversation terminated!]
<bradland> then what?
<phale> I am knowledgable of C:
mistermocha has joined #ruby
<phale> Under no conduct I will be licensed GPLv2
<bradland> fantastic, thanks
<phale> afk im programming
sivsushruth has joined #ruby
<jhass> I don't follow what that should prove either
<jhass> sorry
<phale> Don't worry.
leafybasil has quit [Read error: Connection reset by peer]
<bradland> well, the next time i need to know who is knowledgable in C, i'll have an answer to that one.
<phale> Thank you.
leafybasil has joined #ruby
<jhass> bradland: it doesn't work over the internet, didn't anybody tell you yet!
<bradland> lacks webscale!
<phale> How do I convert this: \xDA#
<phale> into regular characters
<jhass> >> \xDA#
<eval-in_> jhass => /tmp/execpad-bfe3eba3c94b/source-bfe3eba3c94b:2: syntax error, unexpected $undefined ... (https://eval.in/297453)
<jhass> not valid ruby
stef204 has quit [Quit: KVIrc 4.2.0 Equilibrium http://www.kvirc.net/]
iamjarvo has joined #ruby
<jhass> also remember space not enter
teddyp1cker has quit [Remote host closed the connection]
<phale> weird
<phale> >> "\xDA#"
<eval-in_> phale => "\xDA#" (https://eval.in/297454)
<phale> ^
Aswebb_ has quit []
<jhass> which character would \xDA be?
<jhass> # is already one
zata_kyle has joined #ruby
<phale> I don't know. I just got it from binary file parsing.
<phale> According to the BMP specification it's the size of the file in bytes.
<jhass> aha
<bradland> lulz
<phale> What?
<jhass> since when is a size represented in ASCII (or whatever encoding) characters?
<phale> I don't know.
<phale> It says the size in bytes is 4. So I sliced it to 2, 2
<phale> unless that's wrong
<jhass> I don't think it quite says that
<bradland> \xDA is a hexadecimal value, which is just a quantity/number. "character" implies mapping number to a character table.
cazrin has joined #ruby
zata_kyle has quit [Quit: Leaving]
<jhass> maybe it says something like "the first four bytes represent the size"?
<jhass> phale: ^ ?
<phale> yes
<phale> the size in bytes is 4
<phale> not the first four bytes, the first four bytes after bfType
sivsushruth has quit [Ping timeout: 256 seconds]
sivsushruth has joined #ruby
<jhass> well, therefore "something like"
zata has joined #ruby
<jhass> how many bits is that phale?
<phale> what?
<jhass> four bytes
<jhass> how many bits is that
<phale> okay so we know a byte is 8 bits
<jhass> yes
<phale> 32
<phale> I've used it before :(
<jhass> well, you copy pasted it from somebody who gave the right incarnation to you
iamjarvo has quit [Quit: My MacBook has gone to sleep. ZZZzzz…]
teddyp1cker has joined #ruby
<jhass> I'm asking you to come up with what you need yourself here
<phale> okay
<jhass> I already gave you a big hint by letting you calculate the size of the number that represents the data length
grr has quit [Remote host closed the connection]
claptor has joined #ruby
CorySimmons has quit [Quit: Bye!]
fgo has joined #ruby
dfinninger has joined #ruby
zata has left #ruby [#ruby]
nicolastarzia has joined #ruby
zata has joined #ruby
spider-mario has quit [Read error: Connection reset by peer]
RegulationD has joined #ruby
odigity has quit [Ping timeout: 265 seconds]
<shevy> bradland I think I managed to simplify the regex
fgo has quit [Ping timeout: 245 seconds]
dfinninger has quit [Ping timeout: 256 seconds]
decoponio has joined #ruby
grr_ has joined #ruby
millerti has quit [Read error: Connection reset by peer]
<shevy> I am sure it can be made shorter but I am happy that the test data I had works
<phale> "darko drum 12"
<phale> is this part of a BMP file?
<zata> has anyone tried to use the new graylog 1.0 to save rails logs?
<bradland> shevy: impressive dude. i'm amazed you managed to match all these cases.
<shevy> haha
<shevy> I actually started from scratch
<shevy> I started with one, then added the next one
teddyp1cker has quit [Remote host closed the connection]
<shevy> very annoying was "xf86-input-elographics-1.4.1"
<bradland> this regex looks pretty brittle though
Rodya_ has joined #ruby
geefolk has quit [Quit: Leaving]
<shevy> hehe
n80 has quit [Quit: n80]
<shevy> I think years ago I saw Gem do something related to versioned names
<bradland> why _{0,1} followed by [_a-z]* ?
User458764 has quit [Quit: My iMac has gone to sleep. ZZZzzz…]
<bradland> seems redundant
User458764 has joined #ruby
<bradland> oh, i see
<shevy> aha
RegulationD has quit [Ping timeout: 252 seconds]
<phale> shevy: I'm adding BMP to my imageparser :)
<bradland> no, you can't get rid of it, because it changes the pattern
<shevy> those _ and - and \d all mixed up wildly is so annoying
<phale> I added a new class, that kinda extends ImageParser
RegulationD has joined #ruby
Channel6 has joined #ruby
<shevy> good phale
<shevy> now you only need to add documentation
<phale> it is documented
<phale> here and there
<bradland> shevy: IMO, you're going to want to make this thing do a kind of CRC check
zata has quit [Quit: Leaving]
mistermocha has quit [Remote host closed the connection]
<shevy> bradland I did! my brain did!
<bradland> for each record, assemble your match groups and make sure it matches the input string
<shevy> and it failed :(
<bradland> lol
<shevy> see, the biggest thing I actually learned was
<phale> shevy: is [2, 2] a slice of 4 bytes?
<shevy> {0,1} is equal to * right?
<shevy> phale what is this. [] is a method call
<bradland> not exactly
<phale> String[2, 2]
<bradland> it's equivalent to {0,} shevy
<bradland> zero or more
<shevy> >> "phale please learn basic ruby"[2,2]
<eval-in_> shevy => "al" (https://eval.in/297456)
<shevy> bradland ah yes
zata has joined #ruby
<phale> yep that's it
<bradland> {0,1} has more constraint
<phale> thanks shevy!
<phale> i'm going to finish TRPL later, i'm on lambdas and prosc
<phale> procs*
<shevy> phale you can add a [] method to your class too
<phale> for?
serivichi has joined #ruby
<shevy> >> class Foo; def [](i); p i; end; end; Foo.new['hey']
<eval-in_> shevy => "hey" ... (https://eval.in/297457)
<shevy> dunno for
<shevy> I use [] sometimes if I can not remember the name of a method
<bradland> phale: you can only rely on String#[] to give you a fixed number of bytes if you're dealing with ascii or binary encoding types
<shevy> RgbToHex[55,66,33]
<phale> bradland: yeah, ASCII
otisZart has quit [Quit: My Mac has gone to sleep. ZZZzzz…]
<bradland> if dealing with bytes, i would ask for bytes
<bradland> String#byteslice
User458764 has quit [Client Quit]
RegulationD has quit [Ping timeout: 252 seconds]
<bradland> if you're reading a BMP via IO, ruby gives you a string, but you should treat it as binary, and avoid character operations
rdark has joined #ruby
dj_zubehoer has joined #ruby
<bradland> the String class is kind of muddled, because Ruby doesn't have a dedicated binary blob data type
<bradland> many of the functions in String are only relevant for binary data
<eam> the description "binary" is such an odd term to use -- as if any String wasn't entirely binary
RegulationD has joined #ruby
<phale> so i should use byteslice over []?
<phale> mkay
<bradland> eam: while that's true, it's just a common misnomer meaning "raw values"
<eam> yeah
<bradland> the term "string" carries with it the implication that the raw values should be interpreted as characters
<eam> bradland: eh, only in ruby
<bradland> exactly
<eam> strings are historically byte arrays
<bradland> that circles back to my point about String being muddled in Ruby
roolo has quit [Remote host closed the connection]
Rup has joined #ruby
<eam> we agree; just calling out the oddness of the colloquial phrasing
<bradland> phale: the String#[] method respects string encoding, so if you use it, you have to take care that your encodings are correct
<phale> "The second field is a four-byte integer that contains the size of the file in bytes."
odigity has joined #ruby
<phale> but it's not
<phale> it's ascii encoded crap
<phale> am i doing something wrong?
<bradland> rather than rely on String#[], use String#byteslice, is what i'm suggesting
<phale> i see
<bradland> it's not ascii encoded
<bradland> it's raw data
<phale> \xDA
<phale> it's not an integer, though
<eam> phale: \xDA is one quarter of an integer
nicolastarzia has quit [Remote host closed the connection]
<bradland> take a step back
<shevy> lol
doodlehaus has joined #ruby
<bradland> stop thinking of the information you're looking at as a string of characters, because it is not
<shevy> take a byte back
dj_zubehoer has quit [Ping timeout: 272 seconds]
<phale> but then i'll get M
<phale> which is the end of bfType
<bradland> on disk and in memory, it's actually a series of ones and zeros, right?
<Rup> Greetings, rubyists. I have a (hopefully simple) question about EventMachine if anyone is familiar. my existing code is using select() and threads which are relying on heavy use of Socket objects to send/recv to/from clients. I am wondering how I can acquire the Socket object of the connecting clients inside of EM::Connection#post_init.
<bradland> \xDA is Ruby's way of saying a hex escape string
nicolastarzia has joined #ruby
RegulationD has quit [Ping timeout: 255 seconds]
<bradland> when you call puts or inspect, Ruby tries to map the raw data to characters
<bradland> for values that it doesn't have a matching character, it shows you the raw value
<bradland> \xDA is hexadecimal DA
<bradland> that's all
<eam> \xDA is an 8 bit number with a value of 218
<phale> where's the rest of the integer then?
<centrx> in the Recycle Bin
<shevy> hidden
<phale> i'm on linux
<bradland> *facepalm*
LJT has quit [Quit: Sleeping...]
kalusn has joined #ruby
Takle has joined #ruby
iamjarvo has joined #ruby
iamjarvo has quit [Max SendQ exceeded]
iamjarvo has joined #ruby
Sirupsen has joined #ruby
commmmodo has joined #ruby
ndrei has quit [Ping timeout: 256 seconds]
<phale> 271322
<phale> this is correct
ndrei has joined #ruby
<jhass> phale: the header is 14 bytes (2, 4, 2, 2, 4), read those and String#unpack
Takle has quit [Ping timeout: 272 seconds]
<phale> jhass: I know
<phale> it's just weird, when I clicked on my hex editor "show little endian decoding"
<phale> on signed 32 bit and unsigned 32 bit, the actual value was shown on there
<phale> the size of the file in bytes.
sivsushruth has quit [Ping timeout: 256 seconds]
otisZart has joined #ruby
sivsushruth has joined #ruby
serivichi has quit [Ping timeout: 252 seconds]
agrinb has joined #ruby
<eam> ruby internals question: how does MRI do concurrency without using system level threads?
<jhass> I think it does these days
DerisiveLogic has joined #ruby
<eam> I have a situation where I believe the GC is racing with the code
<eam> and according to strace I have only one OS level thread, but it appears as if GC activity is interleaved with the GC
maletor has joined #ruby
agrinb has quit [Read error: No route to host]
agrinb_ has joined #ruby
<eam> I'm also pretty sure this only happens on 2.2.0, I think it may be related to the new incremental GC
<eam> but I don't know enough about how concurrent execution flow occurs within a single thread to say for sure
Cache_Money has joined #ruby
nicolastarzia has quit [Remote host closed the connection]
sivsushruth has quit [Ping timeout: 250 seconds]
sivsushruth has joined #ruby
<jhass> did you try 2.2.1 yet?
Spami has quit [Quit: This computer has gone to sleep]
iamjarvo has quit [Quit: My MacBook has gone to sleep. ZZZzzz…]
<eam> not yet
<eam> is that in rvm?
<jhass> likely
<jhass> make sure to have the latest
Mon_Ouie has quit [Ping timeout: 246 seconds]
CustosLimen has quit [Ping timeout: 256 seconds]
covercash has joined #ruby
qhartman has quit [Quit: Ex-Chat]
mary5030 has joined #ruby
<phale> jhass: does ruby have little endian decoding
<jhass> phale: did you look at String#unpack?
<phale> yeah
<phale> most of the values give me nil
<jhass> I don't believe you
<eam> jhass: I don't see it =/
<jhass> eam: rvm install 2.2.1 errors out?
zata has quit [Quit: zata]
<eam> I have [ruby-]2.20 and [ruby-]2.2-head
pontiki has quit [Ping timeout: 240 seconds]
lemur has joined #ruby
<eam> jhass: ah it'll build it, but it doesn't list it in known
<eam> how does one list all possible installable rvm versions?
Spami has joined #ruby
commmmodo has quit [Quit: commmmodo]
zachrab has joined #ruby
zata has joined #ruby
teddyp1cker has joined #ruby
<grr_> rvm list known?
chipotle has joined #ruby
<phale> jhass: can't find little endian decoding on unpack
<phale> i'm looking at it as we speak on ri
<jhass> phale: press / then type little endian
rbennacer has quit [Remote host closed the connection]
<phale> thanks
<phale> but i've tried that too
<eam> grr_: yeah so, that doesn't mention it
<phale> it gives me nil
<jhass> phale: m(
nicolastarzia has joined #ruby
ypasmk has joined #ruby
zachrab has quit [Ping timeout: 246 seconds]
<phale> jhass: that gives me a blank string
Rodya_ has quit [Remote host closed the connection]
leafybasil has quit [Remote host closed the connection]
ypasmk has quit [Client Quit]
<phale> i've tried all of that before you even told me to search for it
<jhass> proof
<phale> it gives me an array with one element in it, nil
<phale> how do i prove it
chipotle has quit [Client Quit]
blizzy has joined #ruby
<jhass> >> "\xDa\x00\x00\x00".unpack("l<")
<eval-in_> jhass => [218] (https://eval.in/297458)
<jhass> for example
<phale> that's not the size of the file in bytes.
<jhass> of course not
<jhass> I made it up
<phale> nevermind I found it
<phale> apparently i was using the wrong slice
GGMethos has quit [Quit: WeeChat 1.0.1]
<jhass> >> "\xFF\x00\xDa\x00\x00\x00".unpack("s<l<")
<eval-in_> jhass => [255, 218] (https://eval.in/297459)
blackmesa has joined #ruby
<phale> okay i'll go AFK now and i'll not ask questions unless i really need to
chipotle has joined #ruby
covercash is now known as overcrush
thebastl has quit [Quit: Leaving...]
mary5030 has quit [Remote host closed the connection]
asmodlol has quit [Ping timeout: 246 seconds]
ragingcake has quit [Quit: ragingcake]
overcrush is now known as overcrush_
teddyp1cker has quit [Remote host closed the connection]
asmodlol has joined #ruby
Rodya_ has joined #ruby
davidhq_ has joined #ruby
overcrush_ is now known as overcrush
apeiros_ has quit [Remote host closed the connection]
<eam> jhass: yes, it does reproduce on 2.2.1
<eam> but not 2.1.5
<eam> I think I know what's going on
<jhass> cool, your guess sounds sane to me then. Basically just asked so you don't hunt an already solved bug
<eam> yeah I super appreciate the hint -- I didn't even know 2.2.1 was a thing
overcrush has quit []
<jhass> say /topic :P
<eam> ;-)
davidhq has quit [Ping timeout: 264 seconds]
covercash has joined #ruby
covercash has quit [Client Quit]
<eam> I think I found the issue, I just don't know exactly what these mri internals are doing so it's hard to prove
overcrush has joined #ruby
<eam> but concretely, the gc gives up the gvl in an area where I think it shouldn't
Sirupsen has quit [Quit: Textual IRC Client: www.textualapp.com]
<eam> which allows user code to close/open, then when the gc picks back up and runs fclose() in the finalizer it closes the newer descriptor which has been allocated the same integer fd as the old one
overcrush has quit [Client Quit]
<eam> is there a good reference for understanding the mri internals? other than just rtfs?
overcrush has joined #ruby
kayloos has joined #ruby
adriancb has joined #ruby
kalusn has quit [Read error: Connection reset by peer]
commmmodo has joined #ruby
GGMethos has joined #ruby
lolmaus has joined #ruby
dfinninger has joined #ruby
FooMunki_ has quit [Quit: FooMunki_]
mkaesz has joined #ruby
OrbitalKitten has quit [Quit: My MacBook Pro has gone to sleep. ZZZzzz…]
Akuma has joined #ruby
charliesome has quit [Quit: zzz]
Rup has quit [Quit: raisins]
ghostpl_ has joined #ruby
<jhass> rtfj
dfinninger has quit [Ping timeout: 256 seconds]
<phale> jhass: looks japanese
lkba_ has joined #ruby
<jhass> yap
<jhass> that's what the j is for
OrbitalKitten has joined #ruby
tier has joined #ruby
<jhass> (no, I read neither)
LBRapid has quit [Remote host closed the connection]
lkba has quit [Ping timeout: 272 seconds]
kennym has quit [Remote host closed the connection]
otisZart has quit [Quit: My Mac has gone to sleep. ZZZzzz…]
Dolphi has joined #ruby
nateberkopec has joined #ruby
n80 has joined #ruby
OrbitalKitten has quit [Ping timeout: 256 seconds]
amclain has joined #ruby
steffes has joined #ruby
dj_zubehoer has joined #ruby
asmodlol has quit [Quit: Leaving]
roshanavand has joined #ruby
frog|OFF is now known as green-big-frog
tus has joined #ruby
agrinb_ has quit [Quit: Leaving...]
tgunr_ has joined #ruby
dj_zubehoer has quit [Ping timeout: 256 seconds]
tgunr has quit [Ping timeout: 244 seconds]
rkgudboy has joined #ruby
zata has quit [Quit: zata]
sinkensabe has joined #ruby
maletor has quit [Quit: Computer has gone to sleep.]
mikecmpbll has joined #ruby
leafybasil has joined #ruby
mistermocha has joined #ruby
sinkensabe has quit [Ping timeout: 272 seconds]
psy_ has joined #ruby
jottr has quit [Ping timeout: 256 seconds]
psy_ has quit [Max SendQ exceeded]
psy_ has joined #ruby
aspiers has joined #ruby
piotrj has quit []
mistermocha has quit [Ping timeout: 265 seconds]
jottr has joined #ruby
n80 has quit [Quit: n80]
bigmac has joined #ruby
centrx has quit [Quit: Shutting down, Please wait...]
n80 has joined #ruby
IrishGringo has quit [Ping timeout: 265 seconds]
dh64 has quit [Quit: Konversation terminated!]
zachrab has joined #ruby
withnale__ has joined #ruby
grr_ has quit [Remote host closed the connection]
Timba-as has quit [Quit: Be back later ...]
havenwood has joined #ruby
dangerousdave has quit [Quit: My MacBook has gone to sleep. ZZZzzz…]
cazrin has quit [Quit: My Mac has gone to sleep. ZZZzzz…]
Rollabun_ has joined #ruby
Timba-as has joined #ruby
Rollabunna has quit [Read error: Connection reset by peer]
odigity has quit [Ping timeout: 265 seconds]
zachrab has quit [Ping timeout: 250 seconds]
tier has quit [Remote host closed the connection]
plashchynski has quit [Quit: plashchynski]
iwaffles has joined #ruby
zata has joined #ruby
aspiers has quit [Ping timeout: 252 seconds]
zata has left #ruby [#ruby]
lkba_ has quit [Read error: Connection reset by peer]
ebbflowgo has quit [Read error: Connection reset by peer]
Timba-as has quit [Ping timeout: 265 seconds]
ebbflowgo has joined #ruby
seal has joined #ruby
flughafen_ has joined #ruby
kh019267 has joined #ruby
rbennacer has joined #ruby
dcarmich has joined #ruby
ArchRogem has joined #ruby
n80 has quit [Quit: n80]
jottr_ has joined #ruby
otisZart has joined #ruby
greenbagels_ has joined #ruby
steffes has quit []
greenbagels_ has quit [Remote host closed the connection]
greenbagels has joined #ruby
grr_ has joined #ruby
jottr has quit [Ping timeout: 246 seconds]
odigity has joined #ruby
Mives has joined #ruby
otisZart has quit [Read error: Connection reset by peer]
claptor has quit [Quit: this channel is bakas]
ItSANgo has quit [Ping timeout: 246 seconds]
mostlybadfly has quit [Quit: Connection closed for inactivity]
maletor has joined #ruby
ebbflowgo has quit [Read error: Connection reset by peer]
ebbflowgo has joined #ruby
rdark has quit [Quit: leaving]
pontiki has joined #ruby
dfinninger has joined #ruby
Azure has joined #ruby
diegoviola has joined #ruby
RegulationD has joined #ruby
lemur has quit [Remote host closed the connection]
doodlehaus has quit [Remote host closed the connection]
mkaesz has quit [Remote host closed the connection]
dfinninger has quit [Ping timeout: 264 seconds]
bigmac has quit [Read error: No route to host]
bigmac has joined #ruby
oddraisin has quit [Remote host closed the connection]
RegulationD has quit [Ping timeout: 256 seconds]
blueOxigen has joined #ruby
RegulationD has joined #ruby
dandaman has joined #ruby
adriancb has quit [Read error: Connection reset by peer]
adriancb has joined #ruby
bluOxigen has quit [Ping timeout: 252 seconds]
RegulationD has quit [Ping timeout: 240 seconds]
stef204 has joined #ruby
lordkryss has quit [Ping timeout: 256 seconds]
doodlehaus has joined #ruby
RegulationD has joined #ruby
lordkryss has joined #ruby
textblind has joined #ruby
Rodya_ has quit [Remote host closed the connection]
last_staff has joined #ruby
krnlsndrs has joined #ruby
arup_r has joined #ruby
textblind has quit [Client Quit]
SouL has joined #ruby
zhan has joined #ruby
<zhan> im reading ruby on rails tutorial book
<phale> zhan: >>#ror
<zhan> tells me in 1.2.3 to run rails command
<jhass> #rubyonrails
RegulationD has quit [Ping timeout: 245 seconds]
rkgudboy has quit [Ping timeout: 245 seconds]
<zhan> so that's like channel for the book?
ypasmk has joined #ruby
<zhan> how do i register again?
<jhass> /msg ChanServ help
<phale> jhass: anything like scanf?
<phale> scanf("%d %d")
<jhass> String#scan ?
zhan has quit [Client Quit]
<jhass> String#[] ?
<phale> nvm
dtordable has quit [Quit: • IRcap • 8.72 •]
overcrush has quit [Quit: brb]
sivsushruth has quit [Read error: Connection reset by peer]
sinkensabe has joined #ruby
AlexRussia has quit [Ping timeout: 255 seconds]
randiman has joined #ruby
perturbation has joined #ruby
doodlehaus has quit [Remote host closed the connection]
jlast has joined #ruby
sivsushruth has joined #ruby
tearan has joined #ruby
bigmac has quit [Read error: Connection reset by peer]
apeiros_ has joined #ruby
bigmac has joined #ruby
rbennacer has quit [Remote host closed the connection]
Rodya_ has joined #ruby
doodlehaus has joined #ruby
sinkensabe has quit [Ping timeout: 264 seconds]
overcrush has joined #ruby
<phale> is this data-driven?
doodlehaus has quit [Remote host closed the connection]
jottr_ has quit [Ping timeout: 256 seconds]
maletor has quit [Quit: Computer has gone to sleep.]
<jhass> what is it if it isn't?
<phale> vertical tic tac toe
ypasmk_ has joined #ruby
<phale> just regularly event-driven or whatever
ypasmk has quit [Ping timeout: 250 seconds]
ypasmk_ is now known as ypasmk
<jhass> I like that summary http://en.wikipedia.org/wiki/Data_driven
iamjarvo has joined #ruby
teddyp1cker has joined #ruby
<phale> complex data over complex procedures.
gregf has quit [Quit: WeeChat 1.0.1]
<jhass> you seem to yell random terms
mjuszczak has joined #ruby
tvon has quit [Quit: Lost terminal]
<phale> it's not random.
michael_mbp has quit [Excess Flood]
<jhass> what's your question?
michael_mbp has joined #ruby
<phale> is data-driven good?
zachrab has joined #ruby
<jhass> are decimals or rationals better?
<jhass> is the microwave or a regular oven better?
<jhass> it's an approach
<phale> okay
<phale> what's your approach?
<jhass> for some things it may work better, for some things it might not
<jhass> for some things it may just be your preference
<phale> okay.
<jhass> I don't formalize such stuff I guess
<phale> i'll use event-driven when i have no other choice
<phale> data-driven whenever possible
<phale> :)
<jhass> can you rewrite your example to event driven?
<phale> i thought it was event-driven
<jhass> I'd be curious where you draw the line
<jhass> can you rewrite it data driven then?
<phale> oops lo l
<phale> i thought you were talking about something else
<phale> yeah it's data-driven, i can probably try event-driven
hiyosi has quit [Quit: My Mac has gone to sleep. ZZZzzz…]
drewvanstone has joined #ruby
drewvanstone has quit [Client Quit]
<phale> i think this is as event-driven as it can get
drewvanstone has joined #ruby
plashchynski has joined #ruby
zachrab has quit [Remote host closed the connection]
zachrab has joined #ruby
blizzy is now known as _blizzy_
<jhass> I see no difference
teddyp1cker has quit [Remote host closed the connection]
<phale> line 8
<phale> line 5
<jhass> yeah, that's just another way to check the same condition essentially
<jhass> the structure/control flow is exactly the same
<phale> yeah
<phale> but it's not data-driven anymore
<jhass> because?
ArchRogem has quit [Quit: Textual IRC Client: www.textualapp.com]
<phale> i have to modify the program, instead of the data
<jhass> can you elaborate? I can't follow you at all
<phale> see that there board array?
pork_clips has joined #ruby
<jhass> yes
<phale> if i wanted to add more numbers to it, i'd have to edit the control flow of line 5
<jhass> and the array
<phale> the array is the data.
<jhass> you just made your program less flexible
<phale> yes
<phale> I can replace 9 with board.length
zachrab has quit [Ping timeout: 244 seconds]
<jhass> by duplicating a constant (array length)
Spami has quit [Quit: This computer has gone to sleep]
<jhass> the constant is encoded into the array literal
<jhass> one version duplicates it, the initial one just reuses it
<phale> so what's better
_cake has quit [Ping timeout: 256 seconds]
<phale> reusing or duplicating
<havenwood> ovens
<jhass> reusing, of course
<phale> there's your answers.
<phale> s/answers/answer/
<jhass> I strongly refuse that it has anything to do with data driven or event driven
<phale> hm
<jhass> read the wikipedia articles
drewvanstone has quit [Quit: leaving]
matrixfox has joined #ruby
krnlsndrs has quit [Quit: leaving]
krnlsndrs has joined #ruby
mjuszczak has quit []
hololeap has joined #ruby
<jhass> I wouldn't even say they're excluding each other, it's not data or event driven
overcrush has quit [Read error: Connection reset by peer]
lolmaus has quit [Quit: Konversation terminated!]
rbennacer has joined #ruby
rbennacer has quit [Remote host closed the connection]
overcrush_ has joined #ruby
justin_pdx has joined #ruby
mjuszczak has joined #ruby
drewvanstone has joined #ruby
<jhass> and honestly, when it comes to pragmatism, I doubt you'll ever have to reason about them in an application design
lolmaus has joined #ruby
<jhass> it just emerges from your usecases and may be useful for science to talk about your application after the fact
drewvans1one has joined #ruby
drewvans1one has quit [Client Quit]
drewvans1one has joined #ruby
The_Phoenix has quit [Read error: Connection reset by peer]
lolmaus has quit [Client Quit]
mjuszczak has quit [Client Quit]
lolmaus has joined #ruby
pandaant has quit [Remote host closed the connection]
dfinninger has joined #ruby
lkba has joined #ruby
livingstn has joined #ruby
drewvanstone has quit [Quit: leaving]
drewvanstone has joined #ruby
drewvanstone has quit [Client Quit]
dfinninger has quit [Ping timeout: 245 seconds]
drewvanstone has joined #ruby
drewvans1one has quit [Quit: Lost terminal]
twohlix has quit [Quit: justQU.IT]
overcrush_ has quit [Quit: bye!]
papercode has quit [Quit: WeeChat 0.4.3]
green-big-frog is now known as frog|OFF
lys has joined #ruby
leafybasil has quit [Ping timeout: 245 seconds]
sivsushruth has quit [Read error: Connection reset by peer]
morenoh149 has joined #ruby
kaleido has quit [Ping timeout: 245 seconds]
withnale__ has quit [Quit: Be back later ...]
teddyp1cker has joined #ruby
sivsushruth has joined #ruby
arup_r has quit [Quit: ChatZilla 0.9.91.1 [Firefox 36.0/2015022000]]
spider-mario has joined #ruby
kalusn has joined #ruby
kayloos has quit [Read error: Connection reset by peer]
Pupeno has quit [Ping timeout: 272 seconds]
ismaelga has joined #ruby
dj_zubehoer has joined #ruby
RegulationD has joined #ruby
teddyp1cker has quit [Ping timeout: 250 seconds]
sivsushruth has quit [Read error: Connection reset by peer]
michael_mbp has quit [Excess Flood]
kalusn has quit [Remote host closed the connection]
sivsushruth has joined #ruby
dj_zubehoer has quit [Ping timeout: 245 seconds]
RegulationD has quit [Ping timeout: 264 seconds]
roshanavand has quit [Remote host closed the connection]
michael_mbp has joined #ruby
tobacco_joe has quit []
IrishGringo has joined #ruby
kaleido has joined #ruby
kaleido has quit [Changing host]
kaleido has joined #ruby
skj3gg has joined #ruby
jottr_ has joined #ruby
maasha has joined #ruby
xcombelle has joined #ruby
gtrak has joined #ruby
kalusn has joined #ruby
<maasha> Hey, strange thing happening: NoMethodError: undefined method `omit' for #<TestWriteTree:0x007f10ba0ce758> which inhirets from Test::Unit
<maasha> it works fine on my mac, but not on my linux server
<maasha> this is ruby 2.1.2p95
Spami has joined #ruby
motto has joined #ruby
Spami has quit [Client Quit]
perturbation has quit [Quit: Leaving]
m8 has quit [Ping timeout: 252 seconds]
jottr_ has quit [Ping timeout: 245 seconds]
Spami has joined #ruby
Cache_Money has quit [Quit: Cache_Money]
ruind has joined #ruby
<phale> maasha: code?
<ruind> hello I am new to ruby, and I have seen methods called as 'method(param)' and 'method param' when is it right to use the former over the latter and vis-a-versa?
jottr_ has joined #ruby
<phale> ruind: It's good practice to use "method param" where it would be more readable than "method(param)"
<phale> If there are multiple arguments, you should use parenthesis in most cases.
Mon_Ouie has joined #ruby
Mon_Ouie has joined #ruby
<havenwood> or not use parens unless it breaks the interpreter (Seattle style)
<havenwood> ruind: it doesn't matter. just aesthetics.
seal has quit [Quit: Ex-Chat]
<jhass> maasha: do you use a Gemfile?
<maasha> jhass: yes
<havenwood> ruind: some folks like to omit parens whenever possible, because it looks clean. others like to always use them, so it's a bit easier to move code around (but even these folks omit them from #puts and some other frequently used methods).
<jhass> maasha: do you have the .lock checked into the repo? do you run both commands through bundle exec?
lemur has joined #ruby
bim has quit [Remote host closed the connection]
<havenwood> ruind: i tend to like the look of Seattle style.
<maasha> jhass: ahm? I run rake. No .lock in the repo
mjuszczak has joined #ruby
<jhass> maasha: check the lock into the repo, otherwise you miss the entire point of using bundler, also do bundle exec rake to be sure
<phale> zooooooooooom
phale has quit [Quit: leaving]
bigmac has quit [Read error: No route to host]
bigmac has joined #ruby
echevemaster has joined #ruby
<hanmac> shevy: GravityFallsEpisode: http://i.imgur.com/sELAzdR.jpg xD
sevvie has quit [Ping timeout: 264 seconds]
<maasha> jhass: I think I misunderstood you there for a moment. I dont hava a Gemfile. I have a gemspecs file.
riotjones has joined #ruby
sevvie has joined #ruby
leafybasil has joined #ruby
maknz has joined #ruby
<jhass> ah, that's different indeed
<jhass> well, check you got the same minitest version on both
sivsushruth has quit [Read error: Connection reset by peer]
<maasha> jhass: so on my mac minitest is 5.5.1 and on the linux box it is 4.7.5 - so the question: is omit a new method in Test::Unit?
MasterPiece has joined #ruby
<maasha> I would be surprised, but it looks like it.
<jhass> I'm a RSpec'er myself, so I wouldn't know
<jhass> but given it's a different major version, I wouldn't be surprised at all
xcombelle has quit [Quit: Quitte]
sinkensabe has joined #ruby
sivsushruth has joined #ruby
Rephiax has joined #ruby
<maasha> jhass: who would write a test suite for 4 major versions without an omit method?
<jhass> I don't even know what that method does
<maasha> jhass: it skips a test
Stalkr_ has joined #ruby
<jhass> maybe it got renamed?
yqt has joined #ruby
<jhass> zenspider: ^ can you help out there?
ndrei has quit [Ping timeout: 252 seconds]
zachrab has joined #ruby
riotjones has quit [Ping timeout: 246 seconds]
flughafen_ has quit [Quit: WeeChat 1.0]
tgunr_ has quit [Quit: Textual IRC Client: www.textualapp.com]
skj3gg has quit [Quit: ZZZzzz…]
ndrei has joined #ruby
<maasha> jhass: yeah, I also thought that there was supposed to be a flunk and a skip method
bluOxigen has joined #ruby
<jhass> check yourself
<jhass> both list skip, neither list omit
tkuchiki has joined #ruby
drewvanstone has quit [Quit: Lost terminal]
mjuszczak has quit []
<jhass> omit seems to come from the test-unit gem
tkuchiki has quit [Remote host closed the connection]
zachrab has quit [Ping timeout: 252 seconds]
blueOxigen has quit [Ping timeout: 272 seconds]
<havenwood> yeah, doesn't ship with the Test::Unit in Ruby - just the gem
<maasha> omit is from TestCaseOmissionSupport
jottr has joined #ruby
yfeldblum has joined #ruby
<havenwood> in Minitest you `skip`
tkuchiki has joined #ruby
<maasha> havenwood: but there is a neat omit method! At least in the newer version
<havenwood> maasha: newer versions of Minitest?
jottr_ has quit [Ping timeout: 256 seconds]
<havenwood> nuh uh
sivsushruth has quit [Read error: Connection reset by peer]
<havenwood> The Test::Unit gem has since 2008.
sivsushruth has joined #ruby
michael_mbp has quit [Excess Flood]
tkuchiki has quit [Remote host closed the connection]
sivsushruth has quit [Read error: Connection reset by peer]
maletor has joined #ruby
pontiki has quit [Ping timeout: 264 seconds]
michael_mbp has joined #ruby
mjuszczak has joined #ruby
<maasha> skip was renamed to omit or something. there is no skip method in the new version and no omit in the old.
Vivex_ has joined #ruby
sivsushruth has joined #ruby
ypasmk has quit [Quit: ypasmk]
mjuszczak has quit [Client Quit]
<havenwood> maasha: But that's not the case. You probably just have the Test::Unit gem installed on one box and not the other.
Hirzu has joined #ruby
<maasha> it is installed on both boxes :o/
grr_ has quit [Remote host closed the connection]
<havenwood> maasha: Try activating the gem with Kernel#gem.
yfeldblu_ has joined #ruby
Vivex has quit [Ping timeout: 250 seconds]
<havenwood> maasha: You're getting the Test::Unit gem's omit when you're seeing it.
<maasha> havenwood: activate?
dfinninger has joined #ruby
mesamoo has joined #ruby
pontiki has joined #ruby
FooMunki has joined #ruby
sevvie has quit [Ping timeout: 252 seconds]
yfeldblum has quit [Ping timeout: 245 seconds]
iamjarvo_ has joined #ruby
<havenwood> maasha: To ensure you're using the gem, not the built-in Test::Unit: gem 'test/unit'
sinkensa_ has joined #ruby
iamjarvo has quit [Ping timeout: 245 seconds]
dfinninger has quit [Ping timeout: 246 seconds]
Dolphi has quit [Ping timeout: 255 seconds]
sinkensa_ has quit [Remote host closed the connection]
gtrak has quit [Ping timeout: 272 seconds]
RegulationD has joined #ruby
sinkensabe has quit [Ping timeout: 265 seconds]
roshanavand has joined #ruby
maasha has quit [Ping timeout: 246 seconds]
skj3gg has joined #ruby
t_p has quit [Ping timeout: 264 seconds]
<skj3gg> Has anyone here used haml to create generated static error pages (placed in your public directory if possible) for your rails app that uses the application.html.haml layout
marr has joined #ruby
grr_ has joined #ruby
sevvie has joined #ruby
<havenwood> skj3gg: #rubyonrails is the best channel for Rails-related questions.
withnale__ has joined #ruby
<skj3gg> havenwood: thanks
RegulationD has quit [Ping timeout: 246 seconds]
justin_pdx has quit [Quit: justin_pdx]
RegulationD has joined #ruby
_hollywood has quit [Quit: Leaving]
morenoh149 has quit [Ping timeout: 252 seconds]
Sawbones has quit [Remote host closed the connection]
ghostpl_ has quit [Remote host closed the connection]
OrbitalKitten has joined #ruby
User458764 has joined #ruby
NivenHuH has joined #ruby
Sawbones has joined #ruby
WildBamboo-Josh has joined #ruby
shadeslayer has quit [Ping timeout: 256 seconds]
withnale__ has quit [Ping timeout: 264 seconds]
RegulationD has quit [Ping timeout: 255 seconds]
Hirzu has quit [Remote host closed the connection]
martinbmadsen has joined #ruby
Channel6 has quit [Quit: Leaving]
jlast has quit [Remote host closed the connection]
User458764 has quit [Quit: My iMac has gone to sleep. ZZZzzz…]
Sawbones has quit [Ping timeout: 244 seconds]
yekta has joined #ruby
slyv has joined #ruby
_5kg has quit [Ping timeout: 255 seconds]
GnuYawk has joined #ruby
shadeslayer has joined #ruby
Jackneill has quit [Quit: Leaving]
_5kg has joined #ruby
sivsushruth has quit [Read error: Connection reset by peer]
GnuYawk has quit [Client Quit]
Rodya_ has quit [Remote host closed the connection]
GnuYawk has joined #ruby
Rodya_ has joined #ruby
sivsushruth has joined #ruby
rhllor has joined #ruby
User458764 has joined #ruby
nux443 has quit [Ping timeout: 245 seconds]
ismaelga has quit [Remote host closed the connection]
dj_zubehoer has joined #ruby
nux443 has joined #ruby
Wolland has joined #ruby
martinbmadsen has quit [Ping timeout: 246 seconds]
martinbmadsen has joined #ruby
RandyT has quit [Quit: ZNC - http://znc.in]
User458764 has quit [Quit: My iMac has gone to sleep. ZZZzzz…]
sivsushruth has quit [Read error: Connection reset by peer]
adriancb has quit [Read error: Connection reset by peer]
Wolland has quit [Client Quit]
ixti has joined #ruby
adriancb has joined #ruby
sivsushruth has joined #ruby
MatthewsFace has joined #ruby
dj_zubehoer has quit [Remote host closed the connection]
malcolmva has quit [Ping timeout: 256 seconds]
RandyT has joined #ruby
__main__ has quit [Read error: Connection reset by peer]
bim has joined #ruby
unreal_ has joined #ruby
papercode has joined #ruby
unreal has quit [Ping timeout: 256 seconds]
a5i has joined #ruby
sivsushruth has quit [Read error: Connection reset by peer]
sambao21 has joined #ruby
bim has quit [Ping timeout: 246 seconds]
sivsushruth has joined #ruby
dj_zubehoer has joined #ruby
claptor has joined #ruby
hs366 has quit [Quit: Leaving]
Zai00 has quit [Quit: Zai00]
__main__ has joined #ruby
sambao21 has quit [Ping timeout: 252 seconds]
Notte has joined #ruby
malcolmva has joined #ruby
mjuszczak has joined #ruby
enebo has quit [Quit: enebo]
dorei has joined #ruby
sivsushruth has quit [Read error: Connection reset by peer]
sivsushruth has joined #ruby
DEA7TH has quit [Quit: http://quassel-irc.org - Chat comfortably. Anywhere.]
dtordable has joined #ruby
mostlybadfly has joined #ruby
sambao21 has joined #ruby
mjuszczak has quit [Ping timeout: 256 seconds]
michael_mbp has quit [Excess Flood]
bim has joined #ruby
gtrak has joined #ruby
skj3gg has quit [Quit: ZZZzzz…]
michael_mbp has joined #ruby
sambao21 has quit [Quit: Computer has gone to sleep.]
ismaelga has joined #ruby
zachrab has joined #ruby
n80 has joined #ruby
miah has joined #ruby
Mon_Ouie has quit [Ping timeout: 240 seconds]
dfinninger has joined #ruby
adriancb_ has joined #ruby
adriancb has quit [Ping timeout: 256 seconds]
adriancb_ has quit [Read error: Connection reset by peer]
adriancb has joined #ruby
sinkensabe has joined #ruby
zachrab has quit [Ping timeout: 272 seconds]
ebbflowgo has left #ruby [#ruby]
dfinninger has quit [Ping timeout: 246 seconds]
teddyp1cker has joined #ruby
dj_zubehoer has quit [Remote host closed the connection]
sinkensabe has quit [Remote host closed the connection]
kenichi has quit [Quit: ZNC - http://znc.in]
dj_zubehoer has joined #ruby
dj_zubehoer has quit [Client Quit]
teddyp1cker has quit [Remote host closed the connection]
serivichi has joined #ruby
Timba-as has joined #ruby
hololeap has quit [Ping timeout: 252 seconds]
odigity has quit [Ping timeout: 256 seconds]
Rephiax_ has joined #ruby
akkad has quit [Excess Flood]
yekta has quit [Quit: yekta]
withnale__ has joined #ruby
doodlehaus has joined #ruby
akkad has joined #ruby
cazrin has joined #ruby
Rephiax has quit [Ping timeout: 244 seconds]
plashchynski has quit [Quit: plashchynski]
gtrak has quit [Ping timeout: 252 seconds]
ghostpl_ has joined #ruby
simone__ has joined #ruby
Zai00 has joined #ruby
withnale__ has quit [Ping timeout: 256 seconds]
grr_ has quit [Remote host closed the connection]
jlast has joined #ruby
ypasmk has joined #ruby
oki has joined #ruby
serivichi has quit [Ping timeout: 255 seconds]
Takle has joined #ruby
nfk has quit [Quit: yawn]
dorei has quit [Read error: Connection reset by peer]
rippa has quit [Quit: {#`%${%&`+'${`%&NO CARRIER]
tag has quit [Ping timeout: 245 seconds]
odigity has joined #ruby
OrbitalKitten has quit [Quit: Textual IRC Client: www.textualapp.com]
adriancb has quit [Remote host closed the connection]
amundj has joined #ruby
amundj has quit [Client Quit]
n80 has quit [Quit: n80]
plashchynski has joined #ruby
sivsushruth has quit [Read error: Connection reset by peer]
tag has joined #ruby
sivsushruth has joined #ruby
simone__ has quit [Ping timeout: 252 seconds]
dtordable has quit [Quit: • IRcap • 8.72 •]
bim has quit [Remote host closed the connection]
bim has joined #ruby
quazimodo has quit [Ping timeout: 272 seconds]
Rephiax has joined #ruby
bluOxigen has quit [Ping timeout: 272 seconds]
justin_pdx has joined #ruby
DrShoggoth has joined #ruby
Rephiax_ has quit [Ping timeout: 246 seconds]
jonr22 has quit [Remote host closed the connection]
bim has quit [Ping timeout: 244 seconds]
cazrin has quit [Quit: My Mac has gone to sleep. ZZZzzz…]
skaag has quit [Quit: Leaving.]
maletor has quit [Quit: Computer has gone to sleep.]
bim has joined #ruby
n80 has joined #ruby
jonr22 has joined #ruby
bim has quit [Remote host closed the connection]
bim has joined #ruby
bigmac has quit [Read error: No route to host]
sambao21 has joined #ruby
roshanavand has quit [Remote host closed the connection]
bigmac has joined #ruby
Vivex_ has quit [Read error: Connection reset by peer]
last_staff has quit [Quit: last_staff]
Sawbones has joined #ruby
Sawbones has quit [Remote host closed the connection]
bim has quit [Ping timeout: 244 seconds]
neanderslob has quit [Ping timeout: 246 seconds]
ghostpl_ has quit [Ping timeout: 264 seconds]
einarj has joined #ruby
sivsushruth has quit [Read error: Connection reset by peer]
jlast has quit [Remote host closed the connection]
sivsushruth has joined #ruby
mistermocha has joined #ruby
wasamasa is now known as bagelmasa
iamjarvo_ has quit [Quit: My MacBook has gone to sleep. ZZZzzz…]
rbennacer has joined #ruby
Rodya_ has quit [Remote host closed the connection]
sivsushruth has quit [Read error: Connection reset by peer]
bagelmasa is now known as wasamasa
sivsushruth has joined #ruby
FooMunki has quit [Quit: FooMunki]
ValicekB has quit [Ping timeout: 245 seconds]
rbennacer has quit [Ping timeout: 240 seconds]
sambao21 has quit [Read error: Connection reset by peer]
doodlehaus has quit [Remote host closed the connection]
kh019267 has quit [Quit: My MacBook Pro has gone to sleep. ZZZzzz…]
justin_pdx has quit [Quit: justin_pdx]
einarj_ has joined #ruby
Rodya_ has joined #ruby
einarj has quit [Ping timeout: 252 seconds]
RegulationD has joined #ruby
doodlehaus has joined #ruby
zachrab has joined #ruby
einarj has joined #ruby
MasterPiece has quit [Quit: Leaving]
dfinninger has joined #ruby
sambao21 has joined #ruby
diegoviola has quit [Quit: WeeChat 1.1.1]
einarj__ has joined #ruby
einarj_ has quit [Ping timeout: 264 seconds]
ebbflowgo has joined #ruby
Vivex has joined #ruby
rcs has quit [Quit: ZNC - http://znc.in]
RegulationD has quit [Ping timeout: 255 seconds]
Hirzu has joined #ruby
decoponio has quit [Read error: Connection reset by peer]
RegulationD has joined #ruby
IrishGringo has quit [Ping timeout: 265 seconds]
zachrab has quit [Ping timeout: 245 seconds]
einarj has quit [Ping timeout: 265 seconds]
randiman has quit [Quit: (null)]
dfinninger has quit [Ping timeout: 246 seconds]
decoponio has joined #ruby
n80 has quit [Quit: n80]
neanderslob has joined #ruby
ypasmk has quit [Quit: ypasmk]
slyv has quit [Remote host closed the connection]
Hirzu has quit [Ping timeout: 244 seconds]
RegulationD has quit [Ping timeout: 252 seconds]
bigmac has quit [Read error: No route to host]
mistermocha has quit [Remote host closed the connection]
wldcordeiro has joined #ruby
bigmac has joined #ruby
withnale__ has joined #ruby
RegulationD has joined #ruby
Channel6 has joined #ruby
einarj has joined #ruby
Azulinho has joined #ruby
Azulinho has quit [Remote host closed the connection]
zenspider has quit [Quit: bye]
sivsushruth has quit [Read error: Connection reset by peer]
kh019267 has joined #ruby
einarj__ has quit [Ping timeout: 265 seconds]
rhllor has quit [Quit: rhllor]
withnale__ has quit [Ping timeout: 240 seconds]
einarj_ has joined #ruby
sivsushruth has joined #ruby
RegulationD has quit [Ping timeout: 264 seconds]
sivsushruth has quit [Read error: Connection reset by peer]
einarj has quit [Ping timeout: 264 seconds]
einarj__ has joined #ruby
crueber has joined #ruby
sivsushruth has joined #ruby
einarj_ has quit [Read error: Connection reset by peer]
kh019267 has quit [Ping timeout: 264 seconds]
RegulationD has joined #ruby
crueber has quit [Client Quit]
RegulationD has quit [Remote host closed the connection]
Notte has quit [Remote host closed the connection]
Volsus has joined #ruby
jenrzzz has joined #ruby
zenspider has joined #ruby
apeiros_ has quit [Remote host closed the connection]
Rodya_ has quit [Remote host closed the connection]
apeiros_ has joined #ruby
rbennacer has joined #ruby
bigmac has quit [Read error: No route to host]
ptrrr has quit [Quit: ptrrr]
roolo has joined #ruby
<a5i> #sinatra
bigmac has joined #ruby
rbennacer has quit [Ping timeout: 264 seconds]
doodlehaus has quit [Remote host closed the connection]
einarj has joined #ruby
<havenwood> #roda
cazrin has joined #ruby
gregf has joined #ruby
codecop has quit [Remote host closed the connection]
einarj_ has joined #ruby
einarj__ has quit [Ping timeout: 256 seconds]
n80 has joined #ruby
dcarmich has quit [Quit: Textual IRC Client: www.textualapp.com]
einarj has quit [Ping timeout: 246 seconds]
einarj has joined #ruby
einarj_ has quit [Read error: Connection reset by peer]
<jhass> we should all join #hashtag
renier has joined #ruby
bigmac has quit [Read error: No route to host]
bigmac has joined #ruby
renier_ has quit [Ping timeout: 245 seconds]
ghostpl_ has joined #ruby
bigmac has quit [Read error: No route to host]
bigmac has joined #ruby
<godd2> Let's keep it unofficial and do ##hashtag
msmith_ has joined #ruby
sivsushruth has quit [Read error: Connection reset by peer]
msmith_ has quit [Remote host closed the connection]
sivsushruth has joined #ruby
n80 has quit [Quit: n80]
bradleyprice has quit [Remote host closed the connection]
gtrak has joined #ruby
bradleyprice has joined #ruby
<jhass> ##doublehashtag
Sawbones has joined #ruby
User458764 has joined #ruby
einarj has quit [Remote host closed the connection]
bradleyprice has quit [Remote host closed the connection]
<Volsus> hi
banister has joined #ruby
p3ery has joined #ruby
<godd2> what's up?
motto has quit [Quit: Sto andando via]
sambao21 has quit [Quit: Computer has gone to sleep.]
<jhass> godd2: a direction, you may know left and right already
<bradland> up is, most commonly, a proposition relating to objects that are in a position that is higher relative to the point of reference
User458764 has quit [Quit: My iMac has gone to sleep. ZZZzzz…]
<bradland> dangit, jhass
<jhass> bradland: ^5
<godd2> Matz is pedantic so we are pedantic
<bradland> \o
<godd2> No wait, that's not it...
<bradland> lmao
JDiPierro has joined #ruby
<jhass> s/pedantic/bored/
<bradland> i only know because i get asked that question a lot
<bradland> i think it's because people think i'm smart
<bradland> so they ask me
bigmac has quit [Read error: No route to host]
<bradland> that's what other people say anyway: "brad, you're so smart and likeable"
apeiros_ has quit [Remote host closed the connection]
akkad has quit [Excess Flood]
apeiros_ has joined #ruby
gtrak has quit [Ping timeout: 240 seconds]
<godd2> #humblebrag
bigmac has joined #ruby
<bradland> i can't vouch for their credibility
<bradland> but you know
<bradland> hard to argue with the masses
<bradland> and masses, and masses
<jhass> Volsus: don't mind us btw, if you got anything just ask ;)
<bradland> in addition to being humble, many of us know ruby as well! it's amazing really! :)
<Volsus> atm just lurking, thanks tho ^^
<jhass> in the meantime, hangman time! ________ 0/12 [] What's the next character you choose?
JDiPierro has quit [Ping timeout: 265 seconds]
kromm has joined #ruby
akkad has joined #ruby
adriancb has joined #ruby
dfinninger has joined #ruby
maknz has quit [Quit: My Mac has gone to sleep. ZZZzzz…]
quazimodo has joined #ruby
wicope has quit [Remote host closed the connection]
Junaos has quit [Quit: ZNC - http://znc.in]
morenoh149 has joined #ruby
Stalkr_ has quit [Quit: Leaving...]
Joufflu has joined #ruby
dfinninger has quit [Ping timeout: 264 seconds]
teddyp1cker has joined #ruby
cazrin has quit [Quit: Textual IRC Client: www.textualapp.com]
mary5030 has joined #ruby
davidhq_ has quit [Quit: My MacBook Pro has gone to sleep. ZZZzzz…]
quazimodo has quit [Remote host closed the connection]
enebo has joined #ruby
Wolland has joined #ruby
DrShoggoth has quit [Remote host closed the connection]
TheNet has joined #ruby
withnale__ has joined #ruby
gtrak has joined #ruby
teddyp1cker has quit [Ping timeout: 244 seconds]
Wolland has quit [Client Quit]
enebo has quit [Client Quit]
buub has quit [Ping timeout: 264 seconds]
Dolphi has joined #ruby
<TheNet> I need some advice on sockets. I've got two apps that need to communicate with each other. Would it be better to keep a socket connection open all the time between the apps? Or only open one when something needs to be sent?
wldcordeiro has quit [Ping timeout: 256 seconds]
withnale__ has quit [Ping timeout: 252 seconds]
<TheNet> It could be 5 - over 100 connections per day, it's pretty random
ghostpl_ has quit [Ping timeout: 246 seconds]
zachrab has joined #ruby
riotjones has joined #ruby
<jhass> depends on your priorities and resources
<jhass> a permanently open socket connection steadily consumes system resources
<jhass> otoh opening it takes some time so you increase latency
<TheNet> more so than opening a connection?
<jhass> choose what's more important to you
<TheNet> is there a better alternative to sockets?
<TheNet> they're both ruby apps
<havenwood> TheNet: DRb
Sawbones has quit [Remote host closed the connection]
zachrab has quit [Ping timeout: 244 seconds]
<jhass> maintaining the connection requires (granted small) chunk of memory in the kernel and I guess some regular checking for data
<jhass> for IPC? depends on your usecase really
<jhass> probably not
<jhass> it's probably not relevant for your application which approach you choose, pick whichever is nicer to implement to you and do such micro optimizations once you identified a real bottleneck
riotjones has quit [Ping timeout: 245 seconds]
commmmodo has quit [Read error: Connection reset by peer]
cschneid has joined #ruby
commmmodo has joined #ruby
DerisiveLogic has quit [Ping timeout: 264 seconds]
chipotle has quit [Quit: cheerio]
sivsushruth has quit [Read error: Connection reset by peer]
<TheNet> jhass: thanks
<TheNet> havenwood: is that actually better?
<bradland> if i were dealing with 5-100 connections a day, i'd just make them persistent
<TheNet> sockets seem... simpler
<bradland> if you're dealing with socket connections from web clients, where you're going to scale to hundreds of thousands of clients, then you need to start worrying about things like ulimit
sivsushruth has joined #ruby
<bradland> DRb is for RPC, right?
davidhq has joined #ruby
<bradland> sockets are more general, in that you can pass anything across them.
<bradland> just be careful you're not re-implementing something like DRb (poorly)
Shidash has joined #ruby
iamjarvo has joined #ruby
<havenwood> TheNet: DRb is written in pure Ruby. It let's you naturally call methods without rigmarole on the remote Ruby. If you return things that are Marshallable there's no crazy magic.
<havenwood> TheNet: Depends. There are some handy things.
justin_pdx has joined #ruby
bradleyprice has joined #ruby
theoretick has joined #ruby
kirun has quit [Quit: Client exiting]
<bradland> DRb sounds like a dream come true.
<TheNet> It looks nice but I'm already requiring sockets on one of the apps
<bradland> DRb sits on top of sockets.
<bradland> rather than just passing info, you can call remote methods
<bradland> RPC dawg
<TheNet> alright, I guess I'll try it
dumdedum has joined #ruby
<TheNet> havenwood, jhass, bradland: thanks
<havenwood> The documentation is lacking, but when you get the idea it's easy to use.
dumdedum has quit [Client Quit]
<TheNet> would I loop DRb.start_service; DRb.thread.join ?
adriancb_ has joined #ruby
adriancb has quit [Read error: Connection reset by peer]
spider-mario has quit [Read error: Connection reset by peer]
drewvanstone has joined #ruby
fgo has joined #ruby
drewvanstone has quit [Client Quit]
diegoviola has joined #ruby
sevvie has quit [Ping timeout: 244 seconds]
<havenwood> TheNet: If you don't pass args to #start_service it'll be a `front` of `nil`. Looking for a good gist.
davidhq has quit [Quit: My MacBook Pro has gone to sleep. ZZZzzz…]
beneggett has joined #ruby
fgo has quit [Ping timeout: 252 seconds]
hiyosi has joined #ruby
greenarrow has joined #ruby
amclain has quit [Quit: Leaving]
sivsushruth has quit [Read error: Connection reset by peer]
Rephiax has quit [Read error: Connection reset by peer]
<havenwood> TheNet: Well, couldn't find a good gist so here's a basic one: https://gist.github.com/havenwood/5d5fc1cad2fd83008fc1
sivsushruth has joined #ruby
Rephiax has joined #ruby
mary5030 has quit [Remote host closed the connection]
doodlehaus has joined #ruby
rbennacer has joined #ruby
<havenwood> TheNet: So in that case ^, the front is just a Hash.
<TheNet> havenwood: oh wow, thanks!
<havenwood> TheNet: So it's a Hash you can use over the wire. :)
sevvie has joined #ruby
<TheNet> havenwood: if the uri is druby://localhost:xxxx I don't have to lock down any ports, right?
<havenwood> yeah, localhost
ZoanthusR has joined #ruby
adriancb_ has quit [Remote host closed the connection]
jottr has quit [Ping timeout: 256 seconds]
beneggett has quit [Ping timeout: 265 seconds]
<TheNet> havenwood: you required 'drb' whereas the docs examples use 'drb/drb'
kalusn has quit [Remote host closed the connection]
<TheNet> is there a difference?
beneggett has joined #ruby
<havenwood> TheNet: all 'drb' does is in turn: require 'drb/drb'
<TheNet> ah ok
<havenwood> TheNet: I'm just one of those crazy people who do `bundle` instead of `bundle install`, since it's an alias. :P
<havenwood> TheNet: Think of the characters saved!
<havenwood> >.>
bigmac has quit [Read error: Connection reset by peer]
bigmac has joined #ruby
hmsimha has quit [Ping timeout: 252 seconds]
sivsushruth has quit [Read error: Connection reset by peer]
Junaos has joined #ruby
karma42 has joined #ruby
sivsushruth has joined #ruby
dfinninger has joined #ruby
Spami has quit [Quit: This computer has gone to sleep]